3’-Amino modified oligonucleotides demonstrated resistance to 3’-exonuclease activity² and also used as efficient polymerase chain terminator or 3’-blocking group.

Bio-synthesis offers not only wide varieties of 3’-, 5’- and internally amino modified oligonucleotides and also their conjugates with peptides, proteins and antibodies.¹

 Reference:
 

1. http://www.biosyn.com/Bioconjugation.aspx
2. Zendegui, J. G.; Vasquez, K. M.; Tinsley, J. H.; Kessler, D. J.; Hogan, M. E., Nucleic Acids Res., 1992, 20, 307  

• 5' Biotin
• Biotin dT
• Photocleavable PC Biotin
• Desthiobiotin
• 3' Biotin

• Misra, R. R.; Chiang, S. Y.; Swenberg, J. A. Carcinogenesis, 1994, 15, 1647.
• Conrad, F.; Krupp, G., Nucleic Acids Res., 1992, 20, 6423.
• Rosenthal, A.; Jones, D. S. C., Nucleic Acids Res., 1990, 18, 3095.
• Rostok, O.; Odeberg, J.; Rode, M.; Stokke, T.; Fundruck, S.; Smeland, E.; Lunderberg, J., Biotechniques, 1996, 21, 114.
• Huitman, T.; Stahl, S.; Hornes, E.; Uhlen, M., Nucleic Acids Res., 1989, 17, 4937.

A novel bead-based suspension assay using Bridged Nucleic Acid, BNA-NC, probes for the Luminex (USA) LabScan200 flow platform was develop and validated by Shivarov et al. in 2014. This assay allows quantitative detection of DNMT3A p.R882C/H/R/S mutations. The comparison with LNA based probes revealed the superior hybridization characteristics of the BNA based probes. The researchers demonstrated for the first time the benefit of BNA-NC probes coupled to fluorescently labeled beads for quantitative detection of DNMT3A R882 mutations. This type of assay adds to the list of molecular diagnostics techniques used for the analysis of biological markers in genomic and proteomic research. The specific diagnosis and monitoring of diseases enables detection and evaluation of disease risks for individual patients. By analyzing the specifics of a patient’s disease, molecular diagnostics offers the promise to enable and optimize personalized medicine.

Leukemia is an often malignant blood disease that has the tendency to become progressively worse. This type of cancer of the blood or bone marrow is characterized by an abnormal increase of immature white blood cells. However, the term leukemia is also used to cover a whole spectrum of diseases affecting the blood, bone marrow, and lymphoid system, all known as hematological neoplasms. Leukemia is now considered to be a treatable disease. Several hematologic malignant tumors are characterized by genome instabilities. As identified by whole genome sequencing, these cancer types frequently have between 10,000 and 100,000 mutations in their entire genomes. Mutations in the human DNA methyl transferase 3A (DNMT3A) gene have now been identified in several blood diseases. The methyl-group transferring enzyme, DNA methyltransferase 3A (DNMT3A) is one of two human de novo DNA methyltransferases essential for the regulation of gene expression and mutations. and deletions in this protein have been observed in acute myeloid leukemia (AML), Acute lymphoblastic leukemia (ALL), myelodysplastic sydromes and myeloproliferative neoplasms. Myeloid cells represent a prominent part of local inflammatory infiltrates in the central nervous system (CNS) and appear to strongly contribute to the local inflammatory milieu and the pathological outcome of diseases involving these cells.

Kim et al. in 2013 used PCR and direct sequencing to analyze mutations of DNMT3A amino acid residue R882 in 99 acute leukemia patients, including 57 AML patients, 41 ALL patients and a single biphenotypic acute leukemia (BAL) patient. The most common immunophenotype  in BAL patients is defined by the coexpression of B-lymphoid and myeloid markers and less frequently, T-lymphoid and myeloid markers. BAL has a high incidence of clonal chromosomal abnormalities, the most common being the t(9;22) (q34;q11) (Ph chromosome) and structural abnormalities involving 11q23. Data are emerging that BAL has a negative prognosis in both children and adults and this may be related to the underlying chromosome abnormalities. The research group detected DNMT3A expression in mononuclear cells of the bone marrow in these patients and in normal individuals using real‑time quantitative polymerase chain reaction. Approximately 17.5% (10/57) of AML patients were found to exhibit DNMT3A mutations, and four missense mutations were observed in the DNMT3A‑mutated AML patients, including R882 mutations and a novel single nucleotide polymorphism resulting in a M880V amino acid substitution. It is now known that somatic heterozygous mutations of the DNA methyltransferase gene DNMT3A occur frequently in acute myeloid leukemia and other hematological malignancies. The majority (∼60%) of these affect a single amino acid, Arg882 (R882), located in the catalytic domain of the enzyme. In 2013, Kim et al. could show that exogenously expressed mouse Dnmt3a proteins that have the corresponding R878 mutations largely fail to mediate DNA methylation in murine embryonic stem (ES) cells but are capable of interacting with wild-type Dnmt3a and Dnmt3b. The coexpression of the Dnmt3a R878H (histidine) mutant protein resulted in inhibition of the wild-type Dnmt3a and Dnmt3b to methylate DNA in murine ES cells. In addition the expression of Dnmt3a R878H in ES cells containing endogenous Dnmt3a or Dnmt3b induced hypomethylation which suggests that the DNMT3A R882 mutations, in addition to being hypomorphic, have dominant-negative effects. The current literature suggests that the presence of DNMT3A mutations is an adverse prognosis biomarker in adult acute myeloid leukemia and that the rapid detection of DNMT3A R882 codon mutations allows for early identification of poor risk patients with acute myeloid leukemia.

Shivarov et al. therefore set out to develop a novel bead-based suspension assay using BNA-NC probes for the LabScan200 flow platform from Luminex, (USA). The research group developed and validated a bead-based method to quantitatively detect DNMT3A p.R882C/H/R/S mutations using BNA-NC-modified probes. The comparison with probes that were modified with LNAs, a first generation bridged-nucleic acid, revealed the superior hybridization characteristics for the BNA based probes. The researchers demonstrated for the first time the applicability of BNA-NC probes coupled to fluorescently labeled beads for quantitative detection of DNMT3A R882 mutations.

How does the assay work?

1.      Primers are designed to allow for the amplification of a DNA sequence fragment that contains the mutated sequence codon. One of the primers is labeled with biotin.

2.      First, human genomic DNA is extracted from blood.

3.      The exon 23 of the human DNMT3A gene is amplified using the selected forward and reverse primer.

4.      To determine the exact sequence the purified and amplified DNA can be sequenced using Big Dye terminator cycle-sequencing.

5.      Next, the exon 23 DNMT3A fragments are amplified from either genomic or plasmic DNA samples using a 5’-biotinylated forward primer.

6.      Genotyping is performed with the BNA-NC modified oligonucleotide probes connected to microsphere beads, specific for the wild type or the mutant alleles, by direct hybridization.

7.      The captured DNA fragment containing biotin on its 5’-end is detected with the help of streptavidin-phycoerythrine (SAPE) in the hybridization buffer using the LabScan200 flow platform from Luminex (USA). For more detail review Shivarov et al. 2014.  

The outline of the assay is illustrated as follows:


 

Bead-based suspension assay using BNA-NC probes

Figure 1:  Bead-based suspension assay using BNA-NC probes to detect and quantify somatic mutations in leukemia. The amplified DNA fragment containing the mutations is captured by the BNA/DNA probes and quantitatively detected with the help of the SAPE complex allowing the analysis in a Luminex system.

The following illustration explains how the assay works in the Luminex platform.

Bead-based suspension assay using BNA-NC probes

Figure 2:  Bead-based suspension assay using BNA-NC probes and the Luminex system to detect and quantify somatic mutations in leukemia.
1. Primers and probes are designed specific for the mutated sequence codons.
2. DNA is isolated from blood.
3. Amplified by PCR.
4. Biotinylated DNA fragments are captured with the capture probe connected to the beads.
5. Biotinylated DNA fragments are detected with a streptavidin-phycoerythrine (SAPE) complex.
6. The sample is analyzed using a Luminex instrument. The level of SAPE fluorescence is proportional to the amount of the captured DNA fragment.

To illustrate how primers and probes were designed, the location of primer and probe sequences along the DNMT3A reference gene sequence are illustrated in the following paragraph showing a partial sequence segment of the gene containing the mutated target codon.

Sequence Fragment for the DNMT3A gene: gi|340523094|ref|NG_029465.1| Homo sapiens DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), RefSeqGene on chromosome 2:

----

TTTTTCGCCTTCCCTGCTCTTGATGGGGAGGATGCTAGGGCTACGTGTTCGTTACATGCAGACTCCAGGTGTACGTTGCC

GAGCTAACCCTGCAGGAGAGGAGAACTAGAGAGTGTGTCCTGGAGGTATTTCTGAGGGATTGTTCAAAATTACTCTTATT

TCTGCTGGGTTGTGAAACTCTAGGCAGTGATGACCTTACTACCTTTAAGGTCACAGAAACCAGCACAGTGCCTGGCACAT

5’-3’

GGTTGGTGATCTGAGTGCCGGGTTGTTTATAAAGGACAGAAGATTCGGCAGAACTAAGCAGGCGTCAGAGGAGTTGGTGG

                                                 Forward primer

GTGTGAGTGCCCCTGTCCCTGCACTTCGGGTGGCTGCTGGTCCTCCGGGTCCTGCTGTGTGGTTAGACGGCTTCCGGGCA

                                                 |

                                               Biotin

GCCTGGTCTGGCCAGCACTCACCCTGCCCTCTCTGCCTTTTCTCCCCCAGGGTATTTGGTTTCCCAGTCCACTATACTGA

CGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCTGGGCCGGTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCG

    3’-TTGTACTCGGCGAACCGA-5’-BEAD

    5’-AACATGAGCTGCTTGGCG CGC -> TGC; R -> C

    3’-TTGTACTCGGCAAACCGA-5’-BEAD

       AACATGAGCCCCTTGGCG CGC -> CCC; R -> P

    3’-TTGTACTCGGGGAACCGA-5’-BEAD

       AACATGAGCAGCTTGGCG CGC -> AGC; R -> S

    3’-TTGTACTCGTCGAACCGA-5’-BEAD

       AACATGAGCCACTTGGCG CGC -> CAC; R -> H

    3’-TTGTACTCGGTGAACCGA-5’-BEAD

CTCCGCTGAAGGAGTATTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAAGTTAAACAAACAAA

CAAAAAACACAAAACATAATAAAACACCAAGAACATGAGGATGGAGAGAAGTATCAGCACCCAGAAGAGAAAAAGGAATT

TAAAACAAAAACCACAGAGGCGGAAATACCGGAGGGCTTTGCCTTGCGAAAAGGGTTGGACATCATCTCCTGATTTTTCA

ATGTTATTCTTCAGTCCTATTTAAAAACAAAACCAAGCTCCCTTCCCTTCCTCCCCCTTCCCTTTTTTTTCGGTCAGACC

TTTTATTTTCTACTCTTTTCAGAGGGGTTTTCTGTTTGTTTGGGTTTTGTTTCTTGCTGTGACTGAAACAAGAAGGTTAT

           3’-GAAAAGTCTCCCCAAAAGACA-5’

                 Reverse Primer

TGCAGCAAAAATCAGTAACAAAAAATAGTAACAATACCTTGCAGAGGAAAGGTGGGAGAGAGGAAAAAAGGAAATTCTAT

AGAAATCTATATATTGGGTTGTTTTTTTTTTTGTTTTTTGTTTTTTTTTTTTGGGTTTTTTTTTTTACTATATATCTTTT

TTTTGTTGTCTCTAGCCTGATCAGATAGGAGCACAAGCAGGGGACGGAAAGAGAGAGACACTCAGGCGGCAGCATTCCCT

----

Probe Design for BNA/DNA Probes.

This table shows the uniform Tm values for the BNA-NC probes, whereas the LNA probes had slightly lower Tm values. The positions of the modified nucleotide for the BNA-NC probes are shown as well. However, since the positions for the LNA probes are propriotary informatioin, they can not be shown here.

(Source: Shivarov et al. 2014)

The Luminex® 100 and 200™ Systems

The Luminex® 100 and 200™ Systems are analyzers that can perform up to 100 or 200 assays simultaneously in a single well of a microtiter plate. This system is based on the principles of flow cytometry, integrated into the xMAPR technology (multi-analyte profiling beads) enabling the detection and quantitation of multiple RNA or protein targets simultaneously. The xMAP system combines a flow cytometer, fluorescent-dyed microspheres (beads), lasers and digital signal processing to allow multiplexing of up to 100 or 200 unique assays, depending on the instruments used within a single sample. [http://www.lifetechnologies.com/us/en/home/life-science/cell-analysis/immunoassays/luminex-instruments/luminex-200-system.html]

References

Soo Jin Kim, Hongbo Zhao, Swanand Hardikar, Anup Kumar Singh, Margaret A. Goodell, and Taiping Chen; A DNMT3A mutation common in AML exhibits dominant-negative effects in murine ES cells. December 12, 2013; Blood: 122 (25).

Shivarov V, Ivanova M, Naumova E; Rapid Detection of DNMT3A R882 Mutations in Hematologic Malignancies Using a Novel Bead-Based Suspension Assay with BNA-NC(NC) Probes. PLoS One. 2014 Jun 10;9(6):e99769. doi: 10.1371/journal.pone.0099769. eCollection 2014.

Since this molecule is a modified non-typical amino acid it contains an amino group that allows the analysis with the help of standard amino acid analysis or pre- or post-column derivatization prior to the analysis using HPLC-UV or DAD detection. In addition, the non-derivatized amino acid me be detected using liquid-chromatography mass-spectrometry based methods as well.




Acivicin [(2S)-Amino[(5S)-3-chloro-4,5-dihydro-1,2-oxazol-5-yl]ethanoic acid]; molecular formula: C5H7ClN2O3; molar mass: 178.57 g mol−1.

Williams et al. in 2009 solved the crystal structure of the acivicin-modified H.pyloriγ-glutamyltranspeptidase (HpGT). The structure of acivicin-modified HpGT suggests the nucleophilic attack of Thr 380 Oγ at the C3 of acivicin and the displacement of chloride. Furthermore, the researchers report that the integrity of the dihydroisoxazole ring is likely maintained during the reaction since C3 retains its sp² hybridization. The observed unique C-terminal capping of the active site within the acivicin-modified HpGT structure, together with mutagenesis studies, demonstrated that Phe 567 contributes to the overall catalytic efficiency of the enzyme. The researcher examined the contributions of residues within the C-terminal domain of the 20 kDa subunit and found that local structural motifs are critical for optimal enzymatic activity and autoprocessing. These new insights into the HpGT structure and function relationships are proposed to help facilitate the design of future selective γGT inhibitors. Figure 1 depicts the structure model of the acivicin-inhibited γ-glutamyltranspeptidase (γ-GT).



Figure 1:  Structure model of the acivicin-inhibited γ-glutamyltranspeptidase (γ-GT). (Left) The domain structures are highlighted in different colors. (Middle) The secondary structures are highlighted in different colors. (Right) The structure of acivicin is shown and its location inside the protein binding pocket is indicated by the red arrow.

References

Poster DS, Bruno S, Penta J, Neil GL, McGovren JP.; Acivicin. An antitumor antibiotic. Cancer Clin Trials. 1981 Fall;4(3):327-30.

Williams K, Cullati S, Sand A, Biterova EI, Barycki JJ.; Crystal structure of acivicin-inhibited gamma-glutamyltranspeptidase reveals critical roles for its C-terminus in autoprocessing and catalysis. Biochemistry. 2009 Mar 24;48(11):2459-67. doi: 10.1021/bi8014955.

By Klaus Linde

Amino acid analysis allows for the analysis and quantitative detection of tyramine using a standard amino acid analyzer. Amino acid analysis of Tyramine can be performed either with pre-column or post-column modification or labeling since this naturally occurring monoamine contains a primary amino group. In addition, this technique lends itself to quantitatively analyze tyramine levels in food or feed products.

Tyramine can trigger headaches and migraines in some individuals. People who take monoamine oxidase inhibitors or are especially sensitive to tyramine should eat a diet containing low amounts of this amine. High levels of tyramine have been found in aged foods such soy sauce, salami and sauerkraut. The solution to preventing migraines is to eat fresh foods and cut down on the use of prepared and processed foods.

Tyramine, 2-(4-Hydroxyphenyl)ethylamine, 4-(2-Aminoethyl)phenol, or 4-Hydroxyphenethylamine, is a naturally occurring monoamine and trace biogenic and sympathomimetic amine derived from the amino acid tyrosine. Tyramine has the formula HOC6H4CH2CH2NH2 , and a molecular weight of 137.18. Molecular identification numbers of tyramine are the CAS Number 51-67-2, the Beilstein Registry Number 1099914, the EC Number 200-115-8, the MDL number MFCD00008193, and the PubChem Substance ID 24900582.

Figure 1: Tyramine Structure.

The biogenic amine tyramine can act as a catecholamine releasing agent. Catecholamines (CA) are monoamines, organic compounds that have a catechol group, which contain a benzene ring with two hydroxyl side groups and a side-chain amine. The term catechol refers to the 1,2-dihydroxybenzene group. Catecholamines are derived from the amino acid tyrosine and are water-soluble and approximately 50% of catecholamines are bound to plasma proteins when they circulate in the bloodstream. Tyramine by itself is unable to cross the blood-brain barrier and causes only non-psychoactive peripheral sympathomimetic effects. Some of its effects resemble effects of epinephrines. However, a hypertensive crisis can result from ingestion of tyramine-rich foods together with monoamine oxidase inhibitors (MAOIs).

                             Tyrosine                                                                         Tyramine

Figure 2: Tyrosine decarboxylation reaction. According to the wormatlas, tyrosine is converted to tyramine via a decarboxylation reaction by the enzyme tyrosine decarboxylase. Tyramine is further converted to octapamine by the enzyme tyramine β–hydroxylase.

Tyrosine is the precursor to catecholamines and tyramine is a breakdown product of tyrosine. In the gut and during fermentation, tyrosine is decarboxylated to tyramine. During normal metabolism in humans and mammals tyramine is deaminated in the liver to an inactive metabolite. David et al. in 1974 showed using MF1 mice that, as tissue concentrations of tyrosine are increased, decarboxylation becomes increasingly important and, at very high tissue levels, is the predominant route of metabolism. However, when the hepatic monoamine oxidase is inhibited, the clearance of tyramine is blocked and circulating tyramine levels can increase. Elevated levels of tyramine can compete with tyrosine for transport across the blood–brain barrier where it can then enter adrenergic nerve terminals.

Biogenic amines, including tyramine, are molecules that have allergenic properties and are often found in many fermented products. The decarboxylation of tyrosine during fermentation or decay in foods can lead to its presence in many food matrices. The amines are synthesized by lactic acid bacteria through the decarboxylation of amino acids present in the food matrix. However, the concentration of biogenic amines in fermented foodstuffs is influenced by many environmental factors. In addition, it is now known that peptides containing amino acids precursors of biogenic amines can be used by bacteria to produce these biogenic amines. For example, tyramine can be produced from peptides containing tyrosine and free tyrosine is not the only precursor for tyramine production. Tyramine, together with histamine, if present in wine can cause headaches and migranes. The lactobacillus plantarum IR BL0076 strain isolated from wines of the Rhône Valley during aging is known to produce tyramine. Some enological practices, the art of wine making, which lead to an enrichment in nitrogen compounds therefore favor biogenic amine production in wine. Furthermore, tyramine is found in many plants and animals. The molecule is metabolized by the enzyme monoamine oxidase. Tyramine is also present in ergot, mistletoe and putrefied animal matter. Foods that may contain tyramine include ripe cheeses, beers, red wines, meats that are potentially spoiled or pickled, aged, smoked, fermented, or marinated, pork, chocolate, alcoholic beverages, and many fermented foods, such as cheeses, sour cream, yogurt, shrimp paste, soy sauce, and many others. In general tyramine is produced in foods from the natural breakdown of the amino acid tyrosine or tyrosine containing peptides but is not added to foods. Tyramine levels can increase in aging foods, or foods that are fermented or stored for long periods of time. Some fermented foods, and especially cheese, are within the food products more often related with biogenic amines poisoning. During the last century, a close relation between migraine crisis and ingestion of tyramine-rich food, especially cheese, was observed and these effects of tyramine consumption were coined as cheese-reaction.

Tyramine plasma levels, together with plasma tyrosine and methionine levels are significantly elevated in individuals with type II tyrosinemia. This is caused by a deficiency of the enzyme tyrosine aminotransferase. The disorder can affect the eyes, skin, and mental development.

References

Maryse Bonnin-Jusserand, Cosette Grandvalet, Aurélie Rieu, Stéphanie Weidmann and Hervé Alexandre; Tyrosine-containing peptides are precursors of tyramine produced by Lactobacillus plantarum strain IR BL0076 isolated from wine. BMC Microbiology 2012, 12:199.

JEAN-CLAUDE DAVID, WALLACE DAIRMAN, AND SIDNEY UDENFRIEND; Decarboxylation to Tyramine: A Major Route of Tyrosine Metabolism in Mammals. Proc. Nat. Acad. Sci. USA Vol. 71, No. 5, pp. 1771-1775, May 1974.

Daniel M. Linares, Beatriz del Río,Victor Ladero, Noelia Martínez, María Fernández, María Cruz Martín and Miguel A. Álvarez; Factors influencing biogenic amines accumulation in dairy products. Frontiers in Microbiology. 2012, Volume 3, Article 180, 1-10.

http://www.biomedcentral.com/1471-2180/12/199.

http://www.wormatlas.org/neurotransmitterstable.htm

Tyramide Signal Amplification (TSA)

By Klaus D. Linse

Tyramide Signal Amplification is a novel technique using a biotinylated tyramine to detect specific proteins or nucleic acid sequences in-situ, where tyramide, a phenolic compound, has the ability to bind to the electron rich surface of targets.  Signal amplification is the use of specific detection methodologies to directly increase the signal in proportion to the amount of target in a reaction by simultaneously minimizing the possibility of contamination by target amplification products. In general, a reporter group or enzyme is used for this type of reaction. For example, during gene amplification the number of gene copies is increased in cells. One powerful technique used in molecular biology is the polymer chain reaction (PCR) that amplifies target DNA allowing the production of increased quantities of DNA. Some commonly used signal amplification technologies include branched DNA (bDNA) and hybrid capture (HC) assays. Signal amplification is a common method used nowadays to amplify the target signal in in-situ hybridization assays, such as CARD-FISH, with the help of haptens. A hapten can be any small molecule that, when combined with a larger carrier such as a protein, induces the production of antibodies that specifically bind to it either in the free form or connected to carrier molecule.

The general principle of the CARD-FISH or TSA method is illustrated in Figure 1.

Figure 1:  Principle of CARD-FISH or catalyzed reported deposition-fluorescence in-situ hybridization.  

Legend:
H = hapten = biotin, digoxigenin, dinitrophenyl, fluorochrome-labled probe
HRP = horseradish peroxidase; hapten H = fluorochrome = F; B = biotin; stars = flurochrome or enzyme. 
 

1.         Hybridization in-situ involves the use of a hapten such as biotin, dioxigenin, dinitrophenyl, and or a fluorochrom-labeled probe.

2.         The use of a probe covalently conjugated to horseradish peroxidase (HRP) such as an anti-hapten antibody or oligonucleotide.

3.         CARD signal amplification is achieved with hapten-labeled tyramine or a probe labeled with a single flourochrome that enables the use of radicalization of multiple tyramide molecules and hydrogen peroxide.

4.         Deposition of tyramide radicals to tyrosine moieties of proteins in-situ in the vicinity of the site of synthesis.

5.         Direct visualization of flouorochrome-labled tyramines.

6.         Indirect visualization of biotin-labeled or hapten-labeled tyramides with strepavidin, avidin or anti-hapten antibody conjugates labled with fluorochromes. In addition, the use of enzyme precipitation reactions allows the visualization of enzyme activities.

What is TSA or CARD?

Tyramide Signal Amplification, or TSA, sometimes also called Catalyzed Reporter Deposition, or CARD, or tyramine amplification technique (TAT), is an enzyme-mediated detection method that utilizes the catalytic activity of horseradish peroxidase (HRP) for the generation of a high-density labeled target protein or nucleic acid sequence in-situ. Signal amplification in TSA is enabled via binding of biotinylated tyramine to proteins near the site of peroxidase-labeled antibodies. This technique enables reliable detection and quantitation of proteins as well as nucleic acids. In comparison to conventional standard avidin-biotinylated enzyme complex (ABC) based assays, TSA has been reported to increase detection sensitivity up to 100-fold. In addition, TSA can be combined with several other technologies such as nucleic acid labeling, primary and secondary antibodies, avidin and lectin conjugates, cytoskeletal stains, organelle probes and cell tracers based detection techniques. TSA can be used to improve current immunohistochemistry, (IHC), immunofluorescence , (IF), or in-situ hybridization, (ISH), based protocols using existing imaging hardware, for example microscopes.

This amplification method is based on the characteristic ability of tyramine to become chemically sticky after oxidative radicalization. In TSA, HRP reacts with hydrogen peroxide and the phenolic part of tyramine to produce quinone-like structures that carry a radical on the C2 group. But first, the targeted epitope is detected with HRP with the help of specific antibodies. The incubation of the labeled tissue with biotinylated tyramine and hydrogen peroxide (H2O2) results in a peroxide enzyme catalyzed reaction that adds radicals to tyramine. Peroxidases catalyze dehydrogenation by hydrogen peroxide (H2O2) of various phenolic and endiolic substrates in a peroxidatic reaction cycle. Enols are alkenes containing a hydroxyl group connected to one of the carbon atoms at the double bond. Horseradish peroxidase (HRP) can also catalyze a third type of reaction that results in the production of hydroxyl radicals (·OH) from H2O2 in the presence of O2·-. The radicalized tyramine can now bind covalently to nearby tissue molecules, thereby amplifying the signal. The biotin on the bound tyramine serves as a tracer molecule that can be visualized using standard techniques that use avidin-biotin-enzyme complex formation reactions. The conjugation of tyramine molecules to a hapten or fluorochrome make the indirect and direct fluorescence detection of enzymatically deposited tyramides possible.

To illustrate the HRP reaction the conjugation of fluorescein-tyramide to a protein as catalyzed by peroxides is shown in Figure 2.

Figure 2:  Conjugation of fluorescein-tyramine to a protein. The fluorescein-tyramide is covalently linked to a protein tyrosine side chain via peroxidase-mediated formation of the dityrosine adduct.

Principles of Tyramide Signal Amplification

TSA labeling is a combination of several elementary chemical and enzymatic processes (See Figure 1).

• The selected probe is bound to the target using immunoaffinity or hybridization. Secondary detection of the probe is achieved with a HRP-labeled antibody or streptavidin conjugate. Peroxidase conjugates of other targeting proteins such as lectins and receptor ligands may also be suitable for labeling targets as well as endogenous peroxidase activity. In addition, unconjugated HRP can be used as a neuronal tracer often in combination with TSA.
• Multiple copies of a labeled tyramide derivative are activated with HRP. For this, fluorescent or biotinylated tyramide is used. In addition, other hapten-conjugated tyramides, tyramide-conjugated gold particles, as well as other similar molecules may be used.
• The covalent coupling of the resulting highly reactive, short-lived tyramide radicals to residues at the phenol moiety of protein tyrosine residues in the vicinity of the HRP-target interaction site in proximity to the target results in signal localization.

Applications of CARD or TSA

• Fluorescein-labeled tyramine can been used to detect protein oxidation by reactive oxygen species in tissue.
• Detection and quantification of low abundance analytes such as peptide, proteins, DNA or RNA molecules.
• Improving the performance of weakly binding primary antibodies.
• Improving of background by reducing the amount of antibodies or probes needed for the detection.
• Reduction of scanning times which results in the faster production of images.
• Mapping of DNA probes of less than 1 kb size.

References

Rudolf Amann and Bernhard M. Fuchs; Single-cell identification in microbial communities by improved fluorescence in-situ hybridization techniques. Nature Reviews 2008, Volume 6, 339-348.

L.M. Schriml, H.M. Padilla-Nash, A. Coleman, P. Moen1, W.G. Nash2, J. Menninger, G. Jones, T. Ried and M. Dean; Tyramide Signal Amplification (TSA)-FISH Applied to Mapping PCR-Labeled Probes Less than 1 kb in Size. BioTechniques 27:608-613 (September 1999).

Ernst J.M. Speel, Anton H.N. Hopman and Paul Komminoth; Amplification Methods to Increase the Sensitivity of In-Situ Hybridization: Play CARD(S). J Histochem Cytochem 1999, 47: 281.

Reinhard von Wasielewski, Michael Mengel, Suzanne Gignac, Ludwig Wilkens, Martin Werner and Axel Georgii; Tyramine Amplification Technique in Routine ImmunohistochemistryThe Journal of Histochemistry & CytochemistryVolume 45(11): 1455–1459, 1997.

Protein Methylation

By Klaus D. Linse

Proteins are controlled or regulated by a large battery of post-translational modifications (PTMs). Post-translational modification of proteins refers to biochemical events that proteins undergo after translation. Examples of these modification types are methylation, phosphorylation, glycosylation, sulfation, sumoylation, ubiquitinylation, glycosylation, disulfide bonding and others. Post-translational modifications create sites for specific protein-interaction domains. Biochemical research performed during the last decades revealed that in cells protein domains interact in a controlled but dynamic manner and are an important part of regulatory cellular metabolic pathways. Furthermore, post-translational modifications of protein domains define the state of the proteome, a part of cellular organization.

More recently, the inhibition or modulation of protein-protein interactions (PPIs) has become popular in the drug discovery industry. In contrast to traditional drug discovery approaches, the goal is to use the knowledge gained from the study of protein-protein interactions to find new drug candidates or inhibitors. One example for targeted proteins is the protein kinase family. Another example is the search for drugs that allow the treatment of so called “undruggable” diseases.

Methylation alters protein domains or peptide motifs

Proteins can be altered by a diverse set of post-translational modifications. These include the methylation of arginine residues, the methylation, acetylation, ubiquitylation or sumoylation of lysine residues, or prolyl-hydroxylation, and many others. In addition, the presence of multiple post-translational modifications on one protein can have combinatorial effects which can fine tune the regulation of intra-molecular interactions of domain containing proteins.

Today, protein methylation is of wide interest to the scientific field. This hasn’t been always so. Researchers began to study protein methylation in the 1960s, and by the early 1980s, it was known that lysine, arginine, histidine and dicarboxylic amino acids were post-translationally modified. Highly specific enzymes called methyltransferases are known to be responsible for the selective transfer of a methyl group to a targeted molecule. With the availability of modern molecular biology techniques starting in the mid 1990s, is has now become clear that protein methylation is involved in many important functions, including gene regulation and signal transduction.

What is protein methylation?

In chemistry, biochemistry, and biology methylation refers to the addition of methyl groups (-CH₃; the addition of 12 mass units or delta mass = 15 dalton) to organic compounds. This reaction type is a specific case of alkylation. The term alkylation refers to the transfer of an alkyl group, such as the isopropyl group, –CH(CH₃)₂, or the methyl group, -CH₃, from one molecule to another. Alkyl groups may be transferred as alkyl groups with a positively charged carbon atom, a free radical, a carbanion or a carbine. In chemistry, some typical methylation reagents are dimethylsulfate, methanol, methyl halides and diazomethane.

However, it is well established now that many different molecules present in a cell can be methylated. For example, scientists now know that methylation of DNA is epigentically inherited. The methylation of DNA turned out to be an important regulator of gene transcription. The addition of methyl groups to DNA typically occurs at CpG islands or regions. In addition, methylation can also occur in RNA molecules, for example at conserved sequence regions in 18S rRNA. Methylation of cytosine residues in DNA to form 5-methylcytosine has widespread effects on gene expression due to recruiting specific DNA-binding proteins.

In cellular proteins many protein or peptide motifs that contain lysine residues can be methylated or acetylated. These modified motifs can lead to the recognition by other protein domains such as chromo-domains or bromo-domains. Such domains are found in proteins regulating chromatin structure and gene expression. For example, the flexible N-terminal and C-terminal ends of histones are known to contain lysine modifications important for the coupling of histones to changes in chromatin organization and the epigenetic control of gene expression. Typically, a single chromo- or bromo-domain recognizes a suitable modified lysine residue within a short peptide motif sequence.

The monomethylation of a lysine side chain is illustrated in Figure 1 and the structure of S-Adenosyl methionine (SAM), the primary methyl donor molecule in cellular metabolism for numerous biochemical reactions is shown in Figure 2.
 

Figure 1: Monomethylation of a lysine on its ε-amino group. Adenosyl methionine (SAM), a molecule composed of adenosine and methionine, is the primary methyl group donor in metabolism. Donation of the methyl group, in this reaction to the ε-amino group of a lysine, transforms SAM into S-adenyl homocysteine (SAH).

Figure 2: S-Adenosyl methionine (SAM), the primary methyl donor molecule in cellular metabolism for numerous biochemical reactions. During the methionine cycle, methionine is converted to SAM. After transfering its methyl group to a target molecule, SAM is converted to S-adenosyl homocysteine (SAH), which is then further converted to homocysteine. Homocysteine is either converted back to methionine, or enters the trans-sulfuration pathway to form other sulfur-containing amino acids.

The study of lysine methylation of histones has been quite fruitful in recent years after histone lysine methyltransferases were discovered. Histone lysine methylation, either activate or repress gene expression depending on the status of the methylated lysine and its position. However, some of the recently discovered lysine methyl transferases target not only histones but other proteins as well. For example, Set9, a SET domain-containing lysine methyltransferase, was initially found to target histone H3 lysine 4 for mono-methylation but was subsequently shown to target a variety of non-histone proteins as well. Some of its targets are transcription factors.

The SET domain is a 130 to 140 amino acid, evolutionary well conserved sequence motif initially characterized in the Drosophila proteins Su(var)3-9, Enhancer-of-zeste and Trithorax, from which the acronym SET is derived. In addition, the SET domain is found in proteins of diverse functions ranging from yeast to mammals, but also in some bacteria and viruses. Several structures of SET domain proteins have been reported over the past year.  SET domains are folded in a novel way, and adjacent domains are used for both structural stabilization and the completion of their active sites. In addition, the cofactor S-adenosyl-L-methionine and peptide substrates bind on opposite faces of the SET domain. Furthermore, the side chain of the target lysine approaches the transferred methyl group through a narrow channel that passes through the middle of the domain.

Reference

Paik WK, Paik DC, Kim S.; Historical review: the field of protein methylation. Trends Biochem Sci. 2007 Mar;32(3):146-52. Epub 2007 Feb 8.

Bruce T. Seet, Ivan Dikic, Ming-Ming Zhou and Tony Pawson; Reading protein modifications with interaction domains. Nat Rev Mol Cell Biol. 2006 Jul;7(7):473-83.

http://smart.embl.de/smart/do_annotation.pl?DOMAIN=SM00317

Xiao B, Wilson JR, Gamblin SJ.; SET domains and histone methylation. Curr Opin Struct Biol. 2003 Dec;13(6):699-705.

Yang XD, Lamb A, Chen LF; Methylation, a new epigenetic mark for protein stability. Epigenetics. 2009 Oct 1;4(7):429-33. Epub 2009 Oct 10.

1. Gel electrophoresis: Run total of 0.5 µl of the unpurified and 1 µl of the purified dsRNA in 10 µl total volume on a 1% agarose gel. Run 2 µl low mass ladder on a side. Confirm yield and size of single band product.
2. Absorbance measurement at 260 and 280 nm: Concentration can be measured using absorbance at 260 nm because it is well established that a solution of RNA with an optical density of 1.0 (1.0 Absorbance Unit) has a concentration of 50 µg/ml in a 10 mm pathlength cell*. A wavelength of 320 nm is used to compensate for the effects of background absorbance due to, for example, turbidity or high absorbance buffer solution.

1. Fill microvolume cell with water. Set absorbance at 320 nm to zero. This is your background reading.
2. Add 2 µl dsRNA to 78 µl water in microvolume cell. Mix by pipetting.
3. Measure absorbance at 260, 280 and 320 nm.
4. Use formulas for the concentration and for the absorbance ratio to determine concentration and purity of dsRNA.

*Reference: Molecular Cloning, Maniatis et al.

BNA based FISH probes

LINE-1 elements are usually methylated in somatic tissues, and LINE-1 hypomethylation is a common characteristic of human cancers. Alu sequences are also normally methylated in somatic tissues and are thought to become hypomethylated in human cancer cells. Not all Alus are hypomethylated in human cancers. Alu sequences located upstream of the CDKN2A promoter were found to be hypermethylated in cancer cell lines, and an Alu sequence located in intron 6 of TP53 showed extensive methylation in normal and cancer cells. LINEs and SINEs are interspersed throughout the genome, whereas satellite DNA is largely confined to the centromeres or centromere-adjacent (juxtacentromeric) heterochromatin and to the large region of heterochromatin on the long arm of the Y chromosome. Satellite a (Sata) repeats are composed of 170 bp DNA sequences and represent the main DNA component of every human centromere. Satellite 2 (Sat2) DNA sequences are found predominantly in juxtacentromeric heterochromatin of certain human chromosomes and are most abundant in the long juxtacentromeric heterochromatin region of chromosome (Chr) 1. Sat2 sequences are composed of variants of two tandem repeats of ATTCCATTCG followed by one or two copies of ATG. Both Chr1 Sata and Chr1 Sat2 sequences, as well as Sata repeats present throughout all the centromeres, are highly methylated in normal postnatal tissues, hypomethylated in sperm and often hypomethylated in various cancers (26–29). In addition, Sat2 sequences on Chr1 and Chr16 are also hypomethylated in the ICF (immunodeficiency, centromeric region instability and facial abnormalities) syndrome, which usually involves mutations in DNMT3B.

Probe design and preparation

The 23-bp human satellite-2 repeat sequence, attccattcgattccattcgatc, or a 24-bp telomere sequence (ttagggttagggttagggttaggg) representing 4 blocks of 6-bp telomere repeat (ttaggg) are used for the BNA/DNA mixmers with different BNA substitution patterns (Table I). All mixmers oligonucleotides are both synthesized either with a Cy3 or a biotin group at the 5’ end. An unsubstituted DNA oligonucleotide probe is used as a control in each experiment. All the oligonucleotide probes are kept frozen until used in aliquots of distilled water.

Fluorescence in situ hybridization

FISH is carried out as described previously (Silahtaroglu et al., 1998) with the following modifications. The amount of probe is 6.4, 10, 13.4 and 20 pmoles. Denaturation of the target DNA and the probe are performed at 75oC for 5 minutes either separately using 70% formamide or simultaneously under the coverslip in the presence of hybridization mixture containing 50% formamide. In addition, the effect of denaturation is also tested. Two alternative hybridization mixtures are used: 50% formamide/2xSSC (pH 7.0) /10% dextran sulphate or 2xSSC (pH 7.0) /10% dextran sulphate. Hybridization times include 30 min, 1 hr, 2 hrs, 3 hrs and overnight. Hybridization temperatures include: 37°C, 55°C, 60°C and 72°C. Post-washing is either as for standard FISH, or with 50% formamide/2xSSC at 60°C, or without formamide. Hybridization signals with biotin labeled LNA/DNA mixmers are visualized indirectly using two layers of fluorescein labeled avidin (Vector Laboratories, USA) linked by a biotinylated anti-avidin molecule, which amplifies the signal 8-64 times. The hybridization of Cy3-labeled molecules is visualized directly after a short washing procedure. Slides are mounted in Vectashield (Vector Laboratories, USA) containing 4´-6´-diamidino-2-phenylindole (DAPI). The whole procedure is carried out in the dark. The signals are visualized using a Leica DMRB epifluorescence microscope equipped with a SenSys charge-coupled device camera (Photometrics, Tucson, AZ, USA), and IPLAB Spectrum Quips FISH software (Applied Imaging international Ltd., Newcastle, UK) within two days after hybridization. 20 metaphases are analyzed after each hybridization experiment.

Repetitive element in the human genome

Description, primers and probes of repetitive elements  

(Source: Weisenberger et al. 2005)
 

MethyLight

MethyLight is a sodium-bisulfite-dependent, quantitative, fluorescence-based, real-time PCR method to detect and quantify DNA methylation in genomic DNA with high sensitivity. The technique relies on methylation-specific priming combined with methylation-specific fluorescent probing. The combination of the two methylation-specific detection principles results in a highly methylation-specific detection technology. It allows to detect very low frequencies of hypermethylated alleles. The high sensitivity and specificity of MethyLight make it uniquely well suited for detection of low-frequency DNA methylation biomarkers. DNA and RNA based biomarker such as cell-free nucleic acids, mRNA and microRNA releases into the blood stream of cancer patients are increasingly used as target molecules to detect different tumor types or diseases. The quantitative accuracy of real-time PCR and the flexibility to design bisulfite-dependent, methylation-independent control reactions allows for a quantitative assessment of low-frequency methylation events.

References

Jeanpierre, M. (1994). Human satellites 2 and 3. Annals of Genetics 37, 163-171.

Moyzis RK, Buckingham JM, Cram LS, Dani M, Deaven LL, Jones MD, Meyne J, Ratliff RL, Wu JR. (1988) A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci U S A. 85(18):6622-6626.

Sanger Wolfram; Principles of Nucleic Acid Structure. Springer-Verlag, New York, Berlin, Heidelberg, London, Paris, 1984.

Silahtaroglu, A.N., Hacihanefioglu, S., Guven, G.S., Cenani, A., Wirth, J., Tommerup, N., Tumer, Z.(1998) Not para-, not peri-, but centric inversion of chromosome 12. Journal of Medical Genetics 35(8), 682-684.

Silahtaroglu, A.N., Tommerup, N., Vissing, H. (2003) FISHing with Locked Nucleic Acids (LNA): Evaluation of different LNA/DNA Mixmers. Molecular and Cellular Probes 17(4), 165-169.

Daniel J. Weisenberger, Mihaela Campan, Tiffany I. Long, Myungjin Kim, Christian Woods, Emerich Fiala, Melanie Ehrlich and Peter W. Laird; Analysis of repetitive element DNA methylation by MethyLight. Nucleic Acids Research, 2005, Vol. 33, No. 21 6823–6836. doi:10.1093/nar/gki987.