Design of BNANC [NMe] modified oligonucleotidesThe placing of BNA NC [NMe] monomers in oligonucleotides, both, for DNA and RNA, is shown based on examples from published experimental data!| Application | Design example | Length Target | Ref. | | Gene Silencing mRNA | 5’-NNNnnnnnnnnNNN-3’
5′-NNnnnNNNnNnnnnnNnNNn-3′ | 14mer
22mer | Yamamoto
et al. 2012 | | siRNA | 5’-NNNnNnnnnnnnnnnnnnnnn-3’
5’-nnNnnnNnnnNnnnNnnnNnn-3’
5’-nnnnnnnnnnNnNNnnnnnnn-3’
5’-nnNnnNnnnnNnnnnNnnnnn-3’ | 21mer | Rahman et al. 2008 in J. Am. Chem. Soc. 2008, 130, 4886-4896. | | Antisense | 5’-NNnnnnnnnnnnNN-3’ | 14mer | Prakash et al in 2010. | | Aptamer capping | Thrombin binding aptamer was capped at the 3’-end by using BNA-5’-triphosphates and terminal deoxynucleotidyl transferase | | Kasahara et al. 2010 in Bioorganic & Medicinal Chemistry Letters 20(2010) 1626-1629. | Duplex Formation
Target ssRNA | 5’-d(GCGTTTTTTGCT)-3’
5’-d(GCGTTTTTTGCT)-3’
5’-d(GCGTTTTTTGCT)-3’
5’-r(AGCAAAAACGC)-3’ | Tm = 50
Tm = 59
Tm = 80 | Rahman et al. 2005 in Nucleic Acids Symposium Series No. 48 pp 5-6 | Duplex Formation
Target ssRNA | 5’-d(GCGTTYTTTGCT)-3’
5’-d(GCGYTYTYTGCT)-3’
5’-r(AGCAAAAACGC)-3’
Y = 2’,4’-BNANC [NMe] thymine monomer | Tm = 50
Tm = 63 | Rahman et al. 2007 in Nucleosides, Nucleotides, and Nucleic Acids, 26:1625–1628, 2007 | | Selective Duplex Formation with ssRNA | ![]()
5’-d(GCGTTTTTGCT)-3’(7)
5’-d(GCGTTTTTTGCT)-3’(8)
5’-d(GCGTTTTTTGCT)-3’(9)
Change in melting temperature (ΔTm) of modified oligonucleotides relative to 5’-d(GCGTTTTTTTGCT)-3’
Conditions: 4 mM strands solution in 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl.
Target DNA, 5’-d(AGCAAAAAACGC)-3’
Target RNA, 5’-r(AGCAAAAAACGC)-3’ | | Miyashita et al. Chem. Commun., 2007, 3765–3767. | Duplex Formation
Target ssRNA
Target ssDNA | 5-d(GCGTTTTTTGCT)
5’-r(AGCAAAAAACGT)-3’, Tm = 63
5’-r(AGCAAAAAACGT)-3’, Tm = 51 | 12mer | Rahman et al. 2008 in J. Am. Chem. Soc. 2008, 130, 4886-4896. | Triplex Formation
Target dsDNA | 5’-d(TTTTTmCTYTmCTmCTmCT)-3’
5’-d(GCTAAAAAGAAAGAGAGATCG)-3’
3’-d(CGATTTTTCTTTCTCTCTAGC)-5’
Y = 2’,4’-BNANC [NMe] thymine monomer, mC = 5-methylcytidine | Tm = 38 | Rahman et al. 2007 in Nucleosides, Nucleotides, and Nucleic Acids, 26:1625–1628, 2007 | | Triplex Formation(TFO) dsDNA | 5-d(TTTTTCTTTCTCT)
5’-GCTAAAAAGAAAGAGAGATCG)-3’
3’-CGATTTTTCTTTCTCTCTCTAGC)-5’
5’-TTTTTmCTTTmCTmCTmCT-3’
5’-TTTTTmCTTTmCTmCTmCT-3’
5’-TTTTTmCTTTmCTmCTmCT-3’
5’-d(GCTAAAAAGAAAGAGAGATCG)-3’
3’-d(CGATTTTTCTTTCTCTCTAGC)-5’ |
Tm = 59
Tm = 57
Tm = 65 | Rahman et al. 2008
Rahman et al. 2007 in Angew. Chem. Int. Ed. 2007, 46,4306-4309. | | PCR clamping with BNA oligos | The exact ratio of BNA to DNA monomers is dependent on the target Tm value, the length of the oligo, GC%, and target sequence. In general, more than 50% of a15-mer DNA oligo should be modified by BNA-NC units and contain a phosphate group at the 3’-end. | BNA oligos bind more effectively than LNA or PNA oligos. | | | Telomer Fish Probes | | | | | telomere repeat sequence | 5’-CCCTAACCCTAACCCTAA-3’ | Telomers | | | major satellite repeats | 5’-TCGCCATATTCCAGGTC-3’ | Centromeres | | | (TTAGG)4 repeat | 5’-TTAGGTTAGGTTAGG-3’ | Repeats | | | (TTAGGG)n repeat | 5’-TTAGGGTTAGGGTTAGGG-3’ | Repeats | | | (CCCTTA)n repeat | 5’-CCCTTACCCTTACCCTTA-3’ | Repeats | | | repetitive hexameric sequences | 5’-TTAGGGTTAGGGTTAGGG-3’ | distal end of chromosomes | |
N = position of BNA NC [NMe] monomer.
Probes are usually labeled with Cy3 or FITC at the 5’ or 3’ end but other dyes may be used as well.
Concentrations of artificial oligonucleotides and buffers used for BNA experiments by Imanishi and others! | Application | Concentration of oligonucleotide per strand | Buffer | Reference | | Antisense BNAs | 1 micomolar (1 uM) | Buffer: 20 mM sodium phosphate pH 7.2 | Obika et al., 2001 | | Duplex formation | 4 micromolar (uM) | 100 mM NaCl, 10 mM sodium phosphate pH 7.2 | Obika et al., 1998 | | Duplex formation | 4 microM (uM) | 100 mM NaCl, 10 mM sodium phosphate pH 7.2 | Imanishi and Obika 2002 | | Duplex formation | 4 micromolar (uM) | 100 mM NaCl, 10 mM sodium phosphate pH 7.2 | Miyashita et al., 2007 | | Triplex formation | | 140 mM KCl, 10 mM MgCl2, 7 mM sodium phosphate pH 7.0 | Hari et al., 2003 |
More details on design and experimental results:
1. Gene silencing by targeting mRNA usingBNANC[NMe]’s !
Design of BNANC oligonucleotide: 5’-NNNnnnnnnnnNNN-3’,
where N depicts the position of a BNAnc monomer, and n depicts the position of a natural DNA. The use of BNANC’s increased nuclease resistance and improved overall properties for gene silencing by targeting mRNA. Buffer used: 100 mM NaCl, 10 mM sodium phosphate pH 7.2 for thermal melting studies. In vitro transfection was done with Lipofetamine 2000.
2′,4′-BNANC–based AONs are promising therapeutic agents for antisense therapy!! BNANC’s for gene silencing by mRNA targeting!
Yamamoto et al. 2012 showed that 2’,4’-BNANC-based AONs targeting apoB mRNA have higher binding affinities to the target RNA than do 2’,4’-BNA/LNA-based AONs. Additionally, in vitro transfection studies revealed the superior silencing effect of short 2’,4’-BNANC-based AONs (<20-ntlong), indicating that 2’,4’-BNANC may have advantageous properties as short antisense drugs. The BNANCs corresponding to the LNAs showed stronger inhibitory activities. Shorter AONs (13- to 14mers) showed better inhibitory activities. The 2’,4’-BNANC-14mer worked the best.
2. Gene silencing by targeting mRNA!
Design of BNANC oligonucleotide: 5′-NNnnnNNNnNnnnnnNnNNn-3′
Yamamoto et al. 2012: In vitro and in-vivo study. BNANC[NMe]’s with cholesterol lowering action targeting PCSK9 and with increased nuclease resistance and improved properties for gene silencing by targeting mRNA. Yamamoto and colleges achieved a dose-dependent decrease in serum LDL-C levels by using a 2′,4′-BNANC–based AON (P901SNC). Serum HDL-C levels and the levels of liver and kidney toxicity indicators were not elevated. Histopathological analysis revealed no severe hepatic toxicities. They also showed that a 2′,4′-BNANC–based AON (P901SNC) has greater potential to inhibit PCSK9 and to reduce serum cholesterol levels with no toxicity than a conventional 2′,4′-BNA–based AON. The high-potency and low-toxicity characteristics of a 2′,4′-BNANC–based AON were previously reported to effectively inhibit PTEN mRNA without elevation of the serum ALT level, whereas elevated serum ALT was observed in the 2′,4′-BNA counterpart-treated arm. Thus, it was concluded that 2′,4′-BNANC–based AONs can be a promising therapeutic agent for antisense therapy.
3. Interference RNA: => siRNA: BNANC’s for siRNA - RNAi => siRNA
Design of BNANC oligonucleotides that worked best:
5’-NNNnNnnnnnnnnnnnnnnnn-3’,
5’-nnNnnnNnnnNnnnNnnnNnn-3’
5’-nnnnnnnnnnNnNNnnnnnnn-3’,
5’-nnNnnNnnnnNnnnnNnnnnn-3’
Rahman and colleges in 2010 found that 2’,4’-BNA- and 2’,4’-BNANC-modified siRNAs are equally compatible with the RNAi machinery similar to that observed for natural siRNA. To improve siRNA biostability, a number of bridged nucleotide moieties can be incorporated in the sense strand without loss of the usual gene silencing property. Thermally stable functional siRNAs can also be obtained by slightly modifying the middle of the sense and antisense strands together. Unlike the 3’-overhang modification, this modification increased Tm satisfactorily and contains an antisense strand with BNA residues which might be more efficacious in gene silencing. Modification at the Ago2 cleavage site (9–11th positions) produced variable results based on siRNA composition and sequence; usually the modification at the 10th position of the sense strand is more sensitive. Modification at the 11th position of the cleavage site is safer than that of the 10th or 9th position. For the first time, this study as a whole shows the utility and capability of 2’,4’-BNANC, a highly stable and efficient nucleic acid derivative in RNAi technology, and also gives some new ideas about designing biostable, functional siRNAs consisting both of 2’,4’-BNA and 2’,4’-BNANC residues.
4. Antisense oligonucleotide targeting PTEN mRNA
Design of BNANC oligonucleotide:
5’-NNnnnnnnnnnnNN-3’ 14mer
43 d(CUTAGCACTGGCCU)30 20,40-BNANC[NMe] PTEN
Prakash et al in 2010.
5. Aptamer Capping at the 3’-end
A thrombin aptamer was capped with BNAs at the 3’-end. This increased nuclease resistance and the stability of the aptamer. Kasahara et al. 2010.
6. Synthesis of Novel 2’,4’-BNANC [NMe] nucleic acid analog.
Duplex formation: 5-d(GCGTTTTTTGCT)
Target ssRNA 5’-r(AGCAAAAAACGT)-3’, Tm = 63
Target ssdNA 5’-r(AGCAAAAAACGT)-3’, Tm = 51
Triplex formation: 5-d(TTTTTCTTTCTCT) 2’,4’-BNANC [NH] and LNA are better.
Target: dsDNA 5’-GCTAAAAAGAAAGAGAGATCG)-3’
3’-CGATTTTTCTTTCTCTCTCTAGC)-5’ Rahman et al. 2008.
A list of rules for the design of probes using BNAs | BNAs | | (i) | Place one BNA monomer per every 3 bases within an oligomer.
For example in a 20mer oligomer, about 4 BNA monomers can be inserted (there is some degree of freedom as to the exact positions, in other words, they do not have to be exactly every 3 to 6 bases).
According to the specific application, the mode of BNA modification may need to be changed. Both gapmer- and chimera-modification with BNA-NC will be effective for antisense application. More than four continuous natural DNA monomers as part in a BNA-modified oligonucleotide was found to be necessary to recruit RNase H. For diagnostic application, the modification of one bp with a BNA nucleotide maybe enough in some cases. | | (ii) | The spacing of the BNA monomers need not be different within the oligo for different applications. For example, if the spacings are appropriate the same monomer may be used. | | (iii) | The use of no more than 4-8 BNA’s within a 20 mer probe is recommended but is depended on the specific application. | | (iv) | Each BNA –NC monomer increase the Tm by about 4 degrees Celsius. Therefore this can be used to estimate the Tm of the BNA containing oligonucleotide). I agree. | | (v) | An oligonucleotide designed with 2’, 4’-BNA-NC[NH] is more selective to ssRNA and binds more strongly than LNA if more bases are modified. | | (vi) | An oligonucleotide designed with 2’, 4’-BNA-NC[NH] binds also to ssDNA and binds also more strongly than LNA if more bases are modified. The ssDNA binding strength of BNA-NC(NH) is equivalent to (or slightly more than) that of LNA. | | (vii) | BNA-NC(NMe) modification add a very high nuclease-resistance to the oligonucleotide (much more than LNA modification). This property is desirable not only for therapeutic application but also for diagnostic use. | References for the basic properties and some applications for BNA-NC:
Chem. Commun., 2007, 3765;
Angew. Chem. Int. Ed., 2007, 46, 4306;
J. Am. Chem. Soc., 2008, 130, 4886;
Bioorg. Med. Chem., 2010, 18, 3473;
Molecular Therapy NA, 2011, 1, e22;
J. Nucleic Acids, 2012, ID 707323. |
|
