Are you the publisher? Claim or contact us about this channel


Embed this content in your HTML

Search

Report adult content:

click to rate:

Account: (login)

More Channels


Showcase


Channel Catalog


Channel Description:

Latest Articles of Bio-Synthesis Inc.
    0 0
  • 10/12/18--00:00: peptide vaccine development
  • The trials and tribulations of peptide vaccines development.

    Learning from past errors.


    Dante J. Marciani, Sc.D., Ph.D.


    Vaccination or immunization against pathogenic agents has been one of the most successful developments to prevent disease in the history of medicine. Indeed, vaccination goes back as early as the XV century, when in China immunization against smallpox was carried out by inhaling the dry scabs from those affected by the disease. Subsequent developments by Jenner, Pasteur, and others, stablished vaccination as an effective method to prevent some infectious diseases. Moreover, as the understanding of immune protection against infectious agents increased, new refinements to vaccine development were used; like the introduction of the sub-unit vaccines, which frequently avoids immune responses leading to allergies and even autoimmunity. Indeed, the developments that allowed the creation of sub-unit vaccines, also benefited basic research, when the use of antibodies against specific antigens started to be used in biochemistry, microbiology, and others areas. An approach that lead to the development of the monoclonal antibodies by Milstein and Köhler, for which they received the Nobel Prize in Medicine and Physiology in 1984. Hence, antibodies have become an important tool in research; i.e. the initial results derived from basic research have frequently encouraged the development of vaccines against infectious agents and cancer. Hence, due to their relevance in basic research, it is not surprising that sub-unit vaccines, composed of an antigen plus an adjuvant, are the most commonly used. In fact, the antigen directs the immune system to induce a specific response against itself, while the adjuvant decides the nature and magnitude of the immune response against that antigen.

    In fact, vaccine development until two decades ago was sort of an empirical process, where the adjuvant component was frequently a mixture of ill-defined immune stimulators, like the complete Freund’s adjuvant (CFA), which contains whole bacteria. A situation that changed with the discovery of innate immunity, its receptors and ligands; suddenly, a series on well-defined compounds, typically derived from pathogens, were found to induce an immune response by binding to specific cell receptors called Toll-like receptors, or TLRs. This type of response, i.e. innate immunity, has been well-conserved during evolution, with an additional refinement in vertebrates, where innate immunity triggers a more specific, long-term one, called acquired immunity. But, different TLRs induced different kinds of acquired immune responses. Also, TLRs can interact with each other, a situation that may lead to synergic effects, which result in a better immune response, or in other cases in an antagonistic effect, leading to inhibition of the immune response. A result of the induction of immunity via TLRs, is that the acquired response is a pro-inflammatory Th1/Th17 immunity; immunities that are effective in fighting pathogens, but detrimental when they are directed against self-antigens, leading to a new type of increasing diseases, known as autoimmune conditions.

    The increasing popularity of antibodies as protective agents and research tools, has created a frequently chaotic situation, where vaccines or immunization strategies have induced an undesirable response, rather than the beneficial one expected. A consequence of a variety of errors made during the design of those “vaccines,” which may include the immunogen or antigen, as well as the adjuvant, has been the significant number of vaccine failures at the development phase or even at the clinical phase. Mistakes that could have been prevented by a critical evaluation of the vaccine’s different components and a rational approach to their design. Here, we would discuss some of those errors, which have led in many occasions to unexpected and unexplained failures, which frequently have been blamed on the scientific bases supporting a vaccine, rather than the defective design of those vaccines.

    The adjuvant    

    A widespread believe in vaccine development, is the wrong assumption that all adjuvants are created equal; which may have been acceptable more than twenty years ago, before the discovery of innate immunity its receptors and ligands. Indeed, it is common to see papers where an antigen after being found to be immunogenic by using CFA, is then combined with well-defined adjuvants, like QS-21, monophosphoryl lipid A (MPL), and others, expecting to have a similar immune response. A situation that usually results in disappointments and reaching the wrong conclusions, as well as causing delays in the development of critically needed vaccines and frequently abandoning their development. Unfortunately, a frequent explanation for these disappointments, has been to blame the science rather than the poor vaccine design. Indeed, several vaccines that when tested in animals using CFA, induced a strong immune response as determined by in vitro assays, failed in vivo testing. A situation that may be worsened by the fact that in some diseases, the CFA induced immune response may potentiate the disease that it is supposed to prevent and/or treat. A finding that usually led to the wrong conclusion that a vaccine against that disease is impossible; a speculation frequently proven to be wrong, when an adjuvant that induces the right immune response is used to develop an effective vaccine. Hence, while adjuvants like CFA may be practical to elicit the production antibodies against an antigen, it may not be advisable to consider those initial methods as stepping stones to develop a vaccine.  

    To complicate the issue more, the fact is that there are three types of acquired immunity, i.e. Th1 and Th17, which are pro-inflammatory, and Th2 that is anti-inflammatory. Yet, the most common immune responses are Th1 and Th2, with the strongly inflammatory Th17 being less common, but more damaging, as many autoimmune diseases show. Paradoxically, in many papers it is indicated that the optimal immune response must have both pro-and anti-inflammatory immunities, which conveys the impression that a pro-inflammatory immunity, Th1 or Th17, may exist alone and without the anti-inflammatory Th2 immunity, the latter being responsible for the humoral immune response that induces antibody production. Thus, many articles strive to reach that optimal adjuvant that induces both immunities rather than only the pro-inflammatory one. The fact is that there is no adjuvant or agent that can induce a sole pro-inflammatory immunity, Th1 or Th17, since both of them are always followed by the anti-inflammatory Th2 immunity; a relatively newcomer from the evolutionary point of view. Indeed, the milder Th2 immunity always follows the Th1 and/or Th17 immunities, likely as a repair mechanism to ameliorate the damage in the host caused by the pro-inflammatory immunities. Of interest is that different from Th1 and Th17 immunities, Th2 can exist by itself by inhibiting the pro-inflammatory immunities; a property that offers potential therapeutic uses in autoimmunity.

    Hence, as a result of the advances in immunology, derived from the use of genetic as well as biochemistry, medicinal chemistry and other methods to study the immune response, the adjuvant component has evolved from being a “little dirty secret” to a collection of structurally well-defined agonists that by interacting with the appropriate cell-receptors, promote a useful immune response. Interestingly, as indicated before, different immune stimulatory ligands interact with specific receptors to induce an immune response following distinctive pathways; pathways that may be synergistic or antagonistic, depending of the adjuvants. Therefore, a deliverate adjuvants’ selection, can increase and modify the immune response well beyond the limits of that attained with single adjuvants; a strategy that is seldom exploited in vaccine development. Hence, the rational design of effective vaccines, requires a knowledge of the mechanisms of action (MOA) of the different adjuvants, in order to select those that induce an optimal response. Actually, the MOA for several innate immunity ligands, e.g. MPL, CpG oligonucleotides and others ligands, acting on antigen-presenting-cells (APCs), have been elucidated. A more complicated situation is that of the MOA for saponin-based adjuvants like QS-21, where this glycoside acts independently in a coordinate but differential manner, on both T-cells and APCs, to induce a strong pro-inflammatory response. However, while QS-21 is a potent pro-inflammatory adjuvant, a potential drawback is its instability, that results in a change in its immune stimulatory properties, from being a pro-inflammatory to a sole anti-inflammatory adjuvant. A severe problem in vaccines against pathogens or cancer, where a pro-inflammatory immunity is crucial for their efficacy. Saponin-based adjuvants, because of its physicochemical properties and MOA, are sensitive to a vaccine’s formulation; in fact, the addition of non-ionic detergents to QS-21, results in a significant increase in its Th1 immune stimulatory activity. An increase that results in damaging inflammatory effects, like those observed during the AN-1792 vaccine clinical studies against Alzheimer’s disease, which led to terminating this vaccine’s studies. Hence, a rational vaccine design must consider besides the adjuvant and antigen, the nature of the excipients and the possibility that unexpected interactions may lead to unwanted side effects.

    Several strategies have been tried to achieve stabilization of QS-21, most of them using formulations in which this glycoside is sequestered, limiting the exposure of its ester bond between its fucosyl residue and fatty acids to the aqueous environment, to prevent this way its hydrolysis. A protection that can be somewhat achieved by incorporating QS-21 into liposomes, this way removing the ester bond from contact with water; while this approach reduces the hydrolytic process, it does not abolish it, and its effectiveness may be affected by excipients, temperature and other factors. Another strategy has been to replace the labile ester bond by a stable covalent bond, an approach that unfortunately failed to recognize the role of the different chemical structures from QS-21. As a consequence, the final products while reminiscent of QS-21, lack some chemical groups essential for immune stimulation. While these new derivatives induce an antibody immune response, it is unknown which type of immunity, pro- or anti-inflammatory, is being induced; a critical requirement in vaccine design. Another alternative to achieve a stable immune stimulatory glycoside, has been to replace the original acyl group with a new lipophilic chain linked by a stable covalent bond, at a different location in the glycoside, but preserving the groups critical for adjuvanticity. This new compound, GPI-0100, induces a pro-inflammatory immunity, albeit at higher doses than QS-21, but it is stable in an aqueous environment, regardless of the temperature, pH and other factors. Moreover, the immune stimulatory properties of GPI-0100, may be enhanced by changing the vaccines’ formulations. Thus, some effective options have been developed to overcome the instability of the adjuvant QS-21, while retaining most of its unique immune stimulatory properties.     

    An adjuvant commonly used is alum, traditionally presumed to be a sole Th2 adjuvant, is the oldest adjuvant allowed in human vaccines. While its MOA was a mystery for many decades, it has been elucidated; a complex process where uric acid plays the role of an endogenous danger signal, which triggers a complex cascade of events leading to an immune response. Although alum induced response has the characteristics of Th2 immunity, it also elicits some responses associated with pro-inflammatory immunity, e.g. complement activation, induction of IFN-γ production and monocytes activation, all responses that indicate that alum may not be a sole Th2 adjuvant. In fact, that alum has been successfully used for years in infectious disease vaccines where a pro-inflammatory immunity is desirable, points to a potentially not too obvious pro-inflammatory activity. But, alum in contrast to adjuvants like QS-21, does not elicit the production of high affinity or avidity antibodies, characteristic of an effective immune response; which may explain the alum-containing vaccines’ poor performance in the elderly, a classic example being the influenza vaccine. Hence, while safe, alum would be a dubious first choice in view of the new and more effective adjuvants currently available. Hence, it is relevant to identify the type of immune response desired, the need for a long-term memory, production of cytotoxic T-lymphocytes (CTLs), antibody isotype, and other factors, in order to select the best suited adjuvant or combination of adjuvants to fulfill those needs.  

    The immunogen – T-dependent antigens   

    The other vaccine’s critical component is the immunogen, i.e. the antigen, which is supposed to induce an immune response directed against itself, this way providing the antigen-specific response required from vaccines. Hence, it is evident that immunogens are very diverse and their number quite large. Broadly speaking, immunogens can be classified into two groups: T-dependent and T-independent antigens, depending on the need for helper T-cells; the first group is composed of protein antigens while the second is made up of non-protein ones, like polysaccharides and nucleic acids, with lipids being a special group. The best-characterized group is the T-dependent made up of proteins; hence, the present article will be focused on protein and peptide antigens, with a subsequent article dealing with T-independent antigens.

    Proteins, because of their complex structures have a large variety of antigenic determinants or epitopes, which are protein regions recognized by the immune system, i.e. B- and T-cells. Thus, epitopes may be linear, i.e. peptide amino acid sequences, or conformational, which are composed of various discontinuous amino acid sequences which form a 3-dimensional structure, the same that is recognized by the immune system. Actually, conformational epitopes play a crucial role in the interactions with various cellular receptors; hence, these epitopes are important targets for neutralizing antibodies, which by blocking the interactions of these 3D-epitopes with their receptors, interfere with infectivity and processes initiated by stimulatory compounds like growth factors and cytokines. In contrast, the linear epitopes are usually T-cell epitopes, that induce T-cell mediated immunity with secretion of inflammatory cytokines and CTL production. Yet, the initial T-cell immunity will be always followed by an antibody response against that linear epitope. Therefore, it is evident that conformational epitopes would include both B- and T-cell epitopes, to allow the polypeptide chain’s proper folding, in order to achieve the right conformation. Yet, these epitopes may be also formed by discontinuous amino acid residues from a linear polypeptide chain; like in the case where an epitope is formed by contiguous amino acid residues on the surface of an α-helix. In this case, the contiguous amino acids on the coiled peptide, form a linear epitope, amino acids that are surrounded by a diversity of amino acid residues. Hence, it is apparent that peptides have a significant potential to be used as effective immunogens; but, in general the attempts to develop effective vaccines based on peptides have delivered mostly disappointing results.

    A close examination of the principles on which peptide vaccines are founded, shows a series of systematic errors and wrong assumptions that have contributed to those failures.  Peptide vaccines, due to their size and lack of T-helper epitopes, elicit a weak immunity with a poor immunological memory; hence, it has been customary to conjugate the relevant peptides to a carrier protein, like serum albumin, tetanus toxoid and KLH, to provide the necessary T-helper epitopes. However, these proteins cause a phenomenon known as “carrier-induced epitope-specific suppression” or CIESS, where the specific anti-peptide antibody response is suppressed, because the carrier protein induces an antibody response that competes with the anti-peptide response. A situation that results in a weak immune response that frequently is different from the expected anti-peptide. Hence, a new trend is the use of well-defined T-helper epitopes, derived from other proteins, or an artificially designed one, like PADRE. Yet, the carrier problem is often exacerbated by the use of certain cross-linkers, to covalently link the peptide to the carrier protein. For instance, one of the most common linkers used are the heterobifunctional ones carrying both maleimidyl and succinimidyl groups, popular because of their commercial availability and their easy reactivity with the thiol group from cysteine, an amino acid residue added at one of the ends of a peptide of interest. However, due to the high immunogenicity of the maleimide group, the immune response is often directed against that chemical group rather than the peptide, a situation that leads to the suppression of the antipeptide immune response and the researcher’s emotional distress. An unusual situation, since this undesirable effect of the maleimide group has been known for over two decades. Yet, these undesirable effects are not limited to maleimide, but they include other groups with aromatic character, like benzyl and some heterocyclic aromatic compounds.

    Paradoxically, many immunogenic preparations, including some vaccines undergoing clinical studies, has the maleimide group in their conjugated antigens in combination with carrier proteins like KLH. Constructs that may interfere with the production of an effective immune response against the targeted peptide. Thus, the CIESS phenomenon may explain some of the peptide vaccines’ poor clinical results and why their progress has been so far, limited at best, despite of their promise. Still, these negative results are not limited to T-dependent antigens, i.e. proteins and peptides, but they also extend to T-independent antigens, a topic that will be the subject of a future article.

    The excipients

    By definition, an excipient must be inert, i.e. it should not alter the properties of the adjuvant or the immunogen; a situation that frequently is not fulfilled in vaccine development, which leads to unsatisfactory results. A typical example would be that of the AN-1792 vaccine to treat Alzheimer’s disease; a vaccine formulated with the potent pro-inflammatory adjuvant QS-21. Although the selection of that adjuvant to treat a neurodegenerative proteopathy was unwise, the patients receiving the initial vaccine formulation did not show any side-effects in Phase I. But, during the Phase II of such clinical studies and using a vaccine formulation that was modified by addition of a non-ionic detergent, many patients had meningoencephalitis, a damaging brain inflammation; a development that lead to termination of the study. Evidently, those designing this vaccine, were unaware that QS-21 was a potent pro-inflammatory adjuvant, and that the formulation used during Phase I was being altered by the addition of a non-ionic detergent. An apparently innocuous change in formulation, which induced a large increase in the pro-inflammatory activity of QS-21; an alteration that would have discovered in Phase I, if the protocols governing clinical studies would have been followed. Regrettably, those damaging effects due to shortcomings in the vaccine formulation, caused significant damage to that vaccine’s development. Yet, there are cases where an excipient, accidentally may contribute in a positive or negative way to a vaccine’s efficacy.

    A group of excipients that it has been assumed to be inert and stable, is the one composed of various non-ionic detergents, like the detergent used in the AN-1792 vaccine; compounds that are usually used to prevent aggregation of the vaccines’ antigens. Nonetheless, several infectious disease vaccines are formulated with oil-water emulsions that contain non-ionic detergents, as adjuvants. But, a concern that is usually ignored, is that non-ionic detergents oxidize with production of aldehyde groups, which are immunologically active and that can deliver alternative co-stimulatory signals to T-cells, leading to their activation. Therefore, it is likely that those aldehyde groups by delivering a co-stimulatory signal, may contribute to the efficacy of vaccine requiring a pro-inflammatory immunity; yet, it may cause damaging side-effects in cases where the immune response must be an anti-inflammatory one. While it is apparent that those working in vaccine development are largely unaware of the implications of these oxidation products on vaccines’ performance, scientists working with biologics are well aware of those effects. In fact, many therapeutic proteins, like monoclonal antibodies cytokines and other products, suffer changes induced by the reaction of aldehydes with the proteins’ amino groups.

    Hence, during sub-unit vaccine development all of the possible interactions between the different components must be considered, to prevent undesirable and/or unexpected results, which may confuse the subject. But, these comments should also apply to the development of the immunogenic formulas used in basic research; particularly because frequently those initial findings progress to become therapeutic products.

    Relevant publications

    Akira, S. et al. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2001. 2:675-680

    Allen JE, and Wynn TA. Evolution of Th2 immunity: A rapid repair response to tissue destructive pathogens. PLoS Pathog. 2011. 7(5): e1002003

    Bergmann-Leitner ES and Leitner WW. (2014) Adjuvants in the driver’s seat: how magnitude, type, fine specificity and longevity of immune responses are driven by distinct classes of immune potentiators. Vaccines 2014. 2:252–296.

    Boeckler C, et al. Immunogenicity of new heterobifunctional cross-linking reagents used in the conjugation of synthetic peptides to liposomes. J Immunol Methods. 1996. 191:1-10. 

    del Guercio MF, et al. Potent immunogenic short linear peptide constructs composed of B cell epitopes and PAN DR T helper epitopes (PADRE) for antibody responses in vivo. Vaccine 1997. 15, 441–448.

    Genito CJ, et al. Liposomes containing monophosphoryl lipidA and QS-21 serve as an effective adjuvant for soluble circumsporozoite protein malaria vaccine FMP013. Vaccine 2017. 35:3865-3874

    Ghosh M, et al. Carrier protein influences immunodominance of a known epitope: implication in peptide vaccine design. Vaccine, 2013. 31:4682-4688

    Jegerlehner A, et al. Carrier induced epitopic suppression of antibody responses induced by virus-like particles is a dynamic phenomenon caused by carrier-specific antibodies. Vaccine. 2010. 28:5503-5512.

    Kooijman S, et al. Novel identified aluminum hydroxide-induced pathways prove monocyte activation and pro-inflammatory preparedness. J Proteomics. 2018. 175:144-155

    Kornbluth RS and Stone GW. Immunostimulatory combinations: designing the next generation of vaccine adjuvants. J Leukoc Biol. 2006. 80:1084-1102.

    Li W, et al. Peptide vaccine: Progress and challenges. Vaccines, 2014. 2:515-536

    Maggio ET. Polysorbates, peroxides, protein aggregation, and immunogenicity – a growing concern. J Excipients and Food Chem. 2012. 3:45-53

    Marciani DJ, et al. Fractionation, structural studies, and immunological characterization of the semi-synthetic Quillaja saponins derivative GPI-0100. Vaccine. 2003. 21:3961-3971

    Marciani DJ. Vaccine adjuvants: role and mechanisms of action in vaccine immunogenicity. Drug Discov. Today. 2003. 8:934–945.

    Marciani DJ. A retrospective analysis of the Alzheimer’s disease vaccine progress – The critical need for new development strategies. J. Neurochem. 2016. 137:687-700.

    Marciani, DJ. Elucidating the mechanisms of action of saponin derived adjuvants. Trends Pharmacol Sci. 2018. 39:573-585

    Rhodes J.et al. Therapeutic potentiation of the immune system by costimulatory Schiff-base-forming drugs. Nature. 1995. 377:71-75.

    Skwarczynski M and Toth I. Peptide-based synthetic vaccines. Chem Sci. 2016. 7:842-854

    Yamaguchi Y. et al. Guidance for peptide vaccines for the treatment of cancer. Cancer Sci. 2014. 105:924-931


    0 0

    Extracellular vesicles, including exosomes and microvesicles, allow early diagnosis, prognosis and potentially targeted treatments of cancer. Circulating exosomes are a source of stable RNAs including mRNAs, microRNAs, and lncRNAs.

    Exosomes are cell-derived vesicles present in body fluids such as blood, urine, as well as in cell culture mediums. 
    Exosomes are tiny vesicles released from plasma membranes of different cell types. Exosomes are cellular protein complexes that contain enzymes degrading nuclear and cytoplasmic RNA.

    In contrast, endosomes are membrane-bound vesicles present in the cytoplasm formed during endocytosis, the process that transports molecules into the cell by engulfing them with its membrane.

    Apparently all cell types produce extracellular vesicles (EVs). EVs deliver a variety of biomolecules such as lipids, proteins, DNA, mRNA, microRNA as well as long non-coding RNAs (lncRNAs), into cells, dynamically and bidirectionally.



    Classification and definition of extracellular vesicles


    (i)    Small nano-sized exosomes are formed within the cytoplasm by inward budding of endosomes pooled into multivesicular bodies (MVBs). The molecular transporting machinery called “the endosomal sorting complex” is involved in sorting and incorporation of the molecular material into multivesicular bodies (MVBs). MVBs fuse with the cell membrane and release exosomes into the extracellular space,

    (ii)    Nano- to micro-sized vesicles or microvesicles shed from the plasma membrane, and

    (iii)    Micro-sized vesicles are created as byproducts of cell death or apoptotic bodies.

    Long non-coding RNAs (lncRNAs)

    Long non-coding RNAs (lncRNAs) are a heterogeneous group of non-coding transcripts localized in different cell compartments and are usually longer than 200 nucleotides. lncRNAs are non-protein coding RNAs distinct from housekeeping RNAs such as tRNAs, rRNAs, and snRNAs, and independent from small RNAs with a specific molecular processing machinery, for example, micro- or piwi-RNAs.

    lncRNAs are classified into intragenic (intronic or antisense) and intergenic lncRNAs. Some of these are stable, highly expressed and conserved, while others have a high turnover, often are barely detectable and poorly conserved. lncRNAs have diverse functions which they exert by interacting with DNA, RNA and proteins in a sequence-specific and conformational manner, where they can act as a scaffold, a decoy or as enhancer RNA. However, the exact role of exosomal lncRNAs is not at all clear. Dragomir et al. assume that lncRNAs could be a loading vehicle for miRNAs, mRNAs, and other complex molecules into the exosome but this hypothesis will need to be confirmed experimentally. Synthetic lncRNAs may allow more detailed functional studies of these RNA species.

    The structural model for the SINEB2 element of the long non-coding RNA activator of translation AS Uchl1 solved by NMR is an excellent example for a long non-coding RNA (Figure 1. Podbevšek et al. 2018). The invSINEB2/183 RNA folds into a structure with mostly helical secondary structure elements. SINE elements have been hypothesized to act as portable domains in lncRNAs contributing to their biological functions.


    Figure 1: NMR based model of the structure for the SINEB2 element of the long non-coding RNA activator of translation AS Uchl1 (PDB ID: 5LSN). A: A cartoon model of the structure is shown. B: The surface of the SINEB2 element is shown.

    SINEUPs are a new class of natural, synthetic antisense long non-coding RNAs that activate translation. Zuchelli et al. in 2015 reported the discovery of a new functional class of natural and synthetic antisense lncRNAs that stimulate translation of sense mRNAs. The research group named these molecules SINEUPs since for them to function requires the activity of an embedded inverted SINEB2 sequence to UP-regulate translation. The existence of natural SINEUPs suggests that embedded Transposable Elements may represent functional domains in long non-coding RNAs.

    Also, the Zuchelli et al. argue that the design of synthetic SINEUPs to target antisense sequences of mRNAs of choice allows for a scalable increase of protein synthesis of potentially any gene of interest.

    Examples of the categorization for non-coding RNAs

    Category

    Description

    Example

    Intronic

    Expressed from the intron of target.

    DMD lncRNA

    H3K4me3

    Has a methylated H3K4 promoter.

    lincRNA-p21

    Antisense

    Expressed from the non-coding strand and acts on the complementary target.

    BACE1-AS

    Enhancer

    Expressed to enhance expression at a locus at some distance from target.

    p53 eRNAs

    Promoter

    Acting on and expressed from the promoter of target.

    DBE-T

    Intergenic

    Expressed at some distance from coding genes.

    lincRNA00299

    Trans-acting

    Acting at some distance from target

    Evf2

    Cis-acting

    Acting on an adjacent target

    AIRN

    Small

    Less than 200 bp in size

    microRNA 137

    Long

    Greater than 200 bp in size

    Fendrr

    5-UTR

    Expressed near the 5′UTR of target

    5′UTR ELK-1

    (Source: Ernst and Morton, 2013). 

    Examples of lncRNAs showing diversity of functions

    lncRNA

    Biological function

    Antisense-Uchl1

    Enhances translation without interfering with mRNA expression level.

    Gomafu/MIAT

    Neuron-restricted expression; may hinder spliceosome formation and affect the splicing of mRNAs by sequestering splicing factors.

    Hotair

    HOX gene regulation via recruitment of PRC2 in order to silence expression.

    Kcnq1ot1

    Genomic imprinting.

    PCAT-1

    Promotes cell proliferation; target of PRC2 regulation.

    lincRNA-p21

    DNA damage response lincRNA; repressor in p53-dependent transcriptional responses.

    Malat1

    Affects transcriptional and post-transcriptional regulation of cytoskeletal and extracellular matrix genes.

    Panda

    Transcription factor decoy; sequesters transcription factor NF-YA.

    Xist

    Dosage compensation, genomic imprinting, inactivation of X chromosome.

     (Source: Kashi et al. 2016).

    Many lncRNAs are found protected in human body fluids within circulating tumor cells or EVs. These lncRNAs are quite stable and can be extracted from blood or other body fluids as potential biomarkers for disease diagnosis, prognosis and therapy. The expression of lncRNAs can be blocked with antisense oligonucleotides (ASOs), aptamers, hammerhead ribozymes, siRNAs, or small specific molecules. Since some lncRNAs appear to form scaffolds to bind and recruit protein complexes to specific genomic loci, targeting them may open up new ways to treat certain cancers. ASOs as well as CRISPR based method allow studying unknown functions of lncRNA.

    Also, Naderi-Meskin et al. suggested that exosome analysis can be used as a strategy for cancer diagnostics and monitoring dynamic changes during cancer development and therapy. Exosomal lncRNAs as potential diagnosis biomarkers and prognosis indicators in cancer.

    Exosomal lncRNAs as potential diagnosis biomarkers and prognosis indicators in cancer 

    Cancer type

    Exosomal lncRNA

    Sample origin (cohort number)

    Reported findings

    Non-small cell lung cancer (NSCLC)

    MALAT-1

    Serum (healthy controls: 30; NSCLC: 77)

    (I) Diagnosis: Sens =60.1%; Spec =80.9%; AUC: 0.703;

    (II) exosomal MALAT-1 was higher in NSCLC patients and positively associated with advanced TNM stage and lymphatic node metastasis status (P<0.001).

    Laryngeal squamous cell carcinoma (LSCC)

    HOTAIR

    Serum (healthy controls: 30; NSCLC: 77)

    (I) Diagnosis: Sens =92.3%; Spec =57.1%; AUC: 0.727; combined with miR-21; Sens =94.2%; Spec =73.5%; AUC=0.876;

    (II) exosomal HOTAIR levels were higher in LSCC patients (P=0.0264) and positively associated with advanced TNM stage and lymphatic node metastasis status (P<0.01).

    Colorectal cancer (CRC)

    BCAR4

    Serum (healthy controls: 76; colorectal adenoma: 20; CRC: 76)

    (I) Diagnosis: the combination of two mRNA, KRTAP5-4 and MAGEA, with BCAR4 provided a high AUC =0.936 in training cohort and an AUC =0.877 in test cohort; (II) exosomal BCAR4 was down-regulated in CRC patients.

    Colorectal cancer (CRC)

    CRNDE-h

    Serum (healthy controls: 80; hyperplastic polyp: 80; inflammatory bowel disease: 80; colorectal adenoma: 80; CRC: 148)

    (I) Diagnosis: Sens =70.3%; Spec =94.4%; AUC: 0.892;

    (II) exosomal CRNDE-h levels were higher in CRC patients (P<0.01) and positively correlated with regional lymph node metastasis (P=0.019) and distant metastasis (P=0.003);

    (III) high exosomal CRNDE-h levels predict shorter overall survival.

    Colorectal cancer (CRC)

    ZFAS1

    Serum (healthy controls: 37; CRC: 40)

    (I) Diagnosis: Sens =80.0%; Spec =75.7%; AUC: 0.837;

    (II) exosomal ZFAS1 levels were higher in GC patients (P<0.001) and positively associated with lymphatic metastasis (P=0.002) and TNM stage (P=0.025).

    Cervical cancer

    HOTAIR, MALAT1, MEG-3

    Cervicovaginal lavage (HPV negative healthy controls: 30; HPV positive healthy controls: 30; cervical cancer: 30)

    Exosomal HOTAIR and MALAT1 levels were higher, while MEG3 levels were lower in cervical cancer patients compared to HPV negative or positive controls.

    Prostate cancer

    PCA3

    Urine (pairs before and after digital rectal examination: 30)

    Diagnosis: AUC of exosomal PCA3 after DRE: 0.52; AUC after exosomal PCA3 values were normalized to PSA: 0.64.

    Prostate cancer

    lncRNA-p21

    Urine (benign prostatic hyperplasia: 49; prostate cancer: 30)

    (I) Diagnosis: LincRNA-21, Sens =67%; Spec =63%, AUC: 0.663;

    (II) exosomal lincRNA-p21 levels were higher in patients (P=0.016).

    Urothelial bladder cancer (UBC)

    HOTAIR, HOX-AS-2, MALAT-1, lincRoR HYMA1, LINC00477, LOC100506688, OTX2-AS1

    Urine (Cohort 1 — healthy controls: 5; UBC: 8; Cohort 2— healthy controls: 7; UBC: 10)

    All of these exosomal lncRNAs were higher in UBC patients (P<0.01).

     (Source: Dragomir et al. 2018).

    Reference

    Dragomir, M., Chen, B., & Calin, G. A. (2018). Exosomal lncRNAs as new players in cell-to-cell communication. Translational Cancer Research, 7(Suppl 2), S243–S252.

    Ernst, C., & Morton, C. C. (2013). Identification and function of long non-coding RNA. Frontiers in Cellular Neuroscience, 7, 168.

    Hewson C, Morris KV; Form and Function of Exosome-Associated Long Non-coding RNAs in Cancer. Curr Top Microbiol Immunol. 2016;394:41-56. doi: 10.1007/82_2015_486.

    Hojjat Naderi-Meshkin, Xin Lai, Raheleh Amirkhah, Julio Vera, John E J Rasko, Ulf Schmitz; Exosomal lncRNAs and cancer: connecting the missing links, Bioinformatics, , bty527.

    Kaori Kashi, Lindsey Henderson, AlessandroBonetti, PieroCarninci;  Discovery and functional analysis of lncRNAs: Methodologies to investigate an uncharacterized transcriptome. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, Volume 1859, Issue 1, January 2016, Pages 3-15. 

    Podbevšek, P., Fasolo, F., Bon, C., Cimatti, L., Reißer, S., Carninci, P., … Gustincich, S. (2018). Structural determinants of the SINE B2 element embedded in the long non-coding RNA activator of translation AS Uchl1. Scientific Reports, 8, 3189. http://doi.org/10.1038/s41598-017-14908-6.

    Zhang, J., Li, S., Li, L., Li, M., Guo, C., Yao, J., & Mi, S. (2015). Exosome and Exosomal MicroRNA: Trafficking, Sorting, and Function. Genomics, Proteomics & Bioinformatics, 13(1), 17–24. http://doi.org/10.1016/j.gpb.2015.02.001.

    Zucchelli, S., Cotella, D., Takahashi, H., Carrieri, C., Cimatti, L., Fasolo, F., … Gustincich, S. (2015). SINEUPs: A new class of natural and synthetic antisense long non-coding RNAs that activate translation. RNA Biology, 12(8), 771–779. 

     
    ---...---


    0 0

    Guanine rich oligonucleotides allow detection of potassium ions

    Oligonucleotides containing sequences from human telomere DNA or a thrombin binding aptamer can form tetraplex structures upon binding of potassium ions. Structural changes associated with the formation of the tetraplex fold allow the development of potassium-sensing oligonucleotide (PSO) probes or sensors.

    In a PSO, two fluorescent dyes are attached to both terminal ends of the oligonucleotide. Combining fluorophores with a potassium sensing oligonucleotides that allow for fluorescence resonance energy transfer (FRET) or excimer emission based detection methods upon binding of the K+ ion enabling monitoring of K+ ions in biological systems.

    A flexible single-stranded DNA oligonucleotide with a guanine-rich sequence folds into a tetraplex structure in the presence of potassium ions. The single-stranded oligonucleotide, 5’-GGTTGGTGTGGTTGG-3’, when immobilized onto a graphene surface acts as a probe allowing detection of potassium ions in a graphene-based biosensor devise (Lui et al. 2018).

    The potassium ion is essential in biological systems such as the human body such as the maintenance of transmembrane potential and hormone secretion. Therefore, a selective and specific detection and quantification of potassium ions in biological systems would be quite significant. Methods such as fluorescent, electrochemical, and electrical methods allow the selective detection and recognition of K+ ions but maybe not sensitive enough to work for biological systems. Therefore, Lui et al. recently reported the development of a guanine-rich DNA aptamer as a highly sensitive and selective biosensor for the detection of K+ ions. The formation of guanine-quadruplexes from guanine-rich oligonucleotides that have a strong affinity for capturing K+ ions is the basis for this biosensor. 

    Figure 1 shows the structural models for the aptamer-potassium complex as well as for the thrombin-aptamer-potassium complex.

    Figure 1: Structural model of a thrombin-potassium aptamer complex (PDB ID 4DII, left) and the potassium binding aptamer (right) as reported by Krauss et al. in 2012.


    Liu et al. in 2018 used this aptamer for the fabrication of a Hall-effect-based biosensor using single-layer graphene for the detecting of the K+ ion. The biosensor was prepared over wafer-scale areas by a catalytic growth technique of chemical vapor deposition (CVD) employing the Van der Pauw technique which allows monitoring multiple electrical properties of graphene films during the detection process.

    Other potassium sensing oligonucleotides are also possible. For example, Nojima et al. in 2002 synthesized a potassium sensing oligonucleotide with high selectivity for K+ ions as a FRET probe. The researchers connected the fluorophores 6-carboxyfluorescein (6-FAM) and 6-carboxy-tetramethylrhodamine (6-TAMRA) to the oligonucleotide at the 5’- and 3’-terminal ends, respectively, using the DNA sequence GGG TTA GGG TTA GGG TTA GGG for the synthesis. Oligonucleotides carrying this sequence, or a similar one can fold into a tetraplex structure or fold that contains a cavity in which a K+ ion can fit in. The presence of the K+ ion stabilizes the tetraplex structure of the PSO and FRET can occur between the two fluorophores. Circular dichroism (CD) revealed that the two fluorophores are not close to each other in the absence of the potassium ion. This PSO is also reported to detect sodium ions but with a much lower sensitivity, ~43,000-times for K+ over Na+ ions, which suggests that the structure of the tetraplex differs between K+ and Na+

    Reference

    Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F. High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity. Nucleic Acids Res. 2012;40(16):8119-28.

    Xiangqi Liu, Chen Ye, Xiaoqing Li, Naiyuan Cui, Tianzhun Wu, Shiyu Du, Qiuping Wei, Li Fu, Jiancheng Yin, and Cheng-Te Lin; Highly Sensitive and Selective Potassium Ion Detection Based on Graphene Hall Effect Biosensors. Materials 2018, 11, 399.

    Nojima T, Ueyama H, Takagi M, Takenaka S.; Potassium sensing oligonucleotide, PSO, based on DNA tetraplex formation. Nucleic Acids Res Suppl. 2002;(2):125-6.

    Takenaka S, Juskowiak B.; Fluorescence detection of potassium ion using the G-quadruplex structure. Anal Sci. 2011;27(12):1167-72.

    ---...---

     


    0 0

    As reported by Oshima et al. in 2018, inserting bridged nucleic acids (BNAs) into oligonucleotide probes increase the melting temperature (Tm) of the probes leading to an increase of the delta Tm (Δ Tm) between m6A-containing RNA and unmethylated RNA as compared with DNA probes. The insertion of artificial nucleic acids such as BNAs into oligonucleotides increases both binding affinities to the target nucleic acid and sensitivity for detecting a single base mismatch.

    A technique called northeastern blotting allows measuring m6A modifications in RNA. But this method is less efficient, however recent technological developments allow for a more accurate and comprehensive analysis of these modifications in RNA.

    Oshima et al. found that the insertion of bridged nucleic acids (BNAs) into DNA probes increases the difference in melting temperature between N6-methyladenosine (m6A)-containing RNA and unmethylated RNA. This approach allowed the researcher to quantify methylation efficiency at m6A sites in E. coli 23S rRNA with high accuracy. The design of the fluorescent BNA probes is illustrated in figure 1.


    Figure 1: Fluorescent BNA probes for m6A RNAs as designed by Oshima et al. (2018).

    N6-Methyladenosine (m6A) modifications are relatively abundant modifications in RNA molecules in ribosomal RNA (rRNA), small nuclear RNA (snRNA) and messenger RNA (mRNA) of various species. N6-Methyladenosine (m6A) modifications of RNA occur in eukaryotes in mRNA, rRNA, tRNA, and microRNA and appear to be reversible since demethylation enzymes are known to be present in various species. RNA modifications affect RNA splicing, translation, degradation, and localization. Modified RNAs have significant roles in transcriptional control, but their role in the regulation of diverse physiological pathways is still unclear. The structure of a RNA duplex containing m6A is illustrated in figure 2.



    Figure 2: Structure of methylated RNA duplex as reported by Roost et al. in 2015. m6A is oriented anti in a paired duplex, with the methyl group in the anti conformation as well. (A) Structure of the 10 bp duplex with methylated adenosines. (B) Structural model of N6-Methyladenosine as found in RNA. (C) Base pairs alone of m6A/U as found in the duplex.


    m6A modifications influence many physiological processes such as circadian rhythms, stem cell pluripotency, fibrosis, triglyceride metabolism, and obesity. m6A modifications are thought to control RNA degradation, localization, and splicing. However, their exact role in pathophysiological states is still unclear. Therefore, one can reason that the investigation of m6A modifications are essential to provide insights into molecular physiology and molecular pathways influenced by this modification.

    .

    Reference

    Roost C, Lynch SR, Batista PJ, Qu K, Chang HY, Kool ET. Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015;137(5):2107-15.

    Oshima T , Ishiguro K , Suzuki T , Kawahara Y .; Quantification of methylation efficiency at a specific N6-methyladenosine position in rRNA by using BNA probes. Chem Commun (Camb). 2018 Aug 23;54(69):9627-9630. doi: 10.1039/c8cc03713b.

    Wang CY, Lin MH, Su HT. A Method for Measuring RNA N 6-methyladenosine Modifications in Cells and Tissues. J Vis Exp. 2016;(118):54672. Published 2016 Dec 5. doi:10.3791/54672

     

    0 0

    Applications for Bridged Nucleic Acids (BNAs)



    BNA Clamping


    BNA clamp oligonucleotides inhibit DNA primer extension on a single-stranded template and also arrest reverse transcription on a single-stranded RNA template. Clamp oligonucleotides are useful tools for sequence-specific control of gene expression as well as for a therapeutic agent. Clamping oligonucleotides are single-stranded nucleic acids recognized by a complementary (antisense) oligonucleotide to form a short double helix.

    Oligopyrimidine-oligopurine helical formations are recognized by a third clamping oligonucleotide forming triple helices. Two oligonucleotides can be linked to each other such that they form a unique clamp with the target sequence on the single-stranded template (Giovannangeli et al. 1991).

    Mutations on the epidermal growth factor receptor (EGFR) cause a variety of cancers including breast and lung cancers. The single mutation T790M on tyrosine kinase domain of EGFR signifies the response to the popular cancer drug gefitinib, which leads to the development of resistance to gefitinib. Detecting the mutation thus guide effective therapeutical options for patients who are in need of cancer drug treatments. BNANC clamping using real-time PCR enables effective detection of the EGFR single mutation T790M. Read the BSI Poster (Detection Method for the EGFR Single Mutation T790M).

    Reference

    Giovannangeli et al., Single-Stranded DNA as a Target for Triple-Helix Formation, J. Am. Chem. Soc., 113, 7775-7777 (1991).



    BNANC Gapmers


    BNANC Gapmers revert splicing and reduce RNA Foci in myotonic dystrophy type 1 (
    DM1) cells. DM1 is a multisystemic disease caused by an expanded CTG repeat in the 3’-untranslated region (UTR) of the dystrophia myotonica protein kinase (DMPK) gene. Gapmers targeting within the repetitive region of DMPK preferentially degrades the mutant allele. 

    Myotonic dystrophy is the most common type of muscular dystrophy in which the expanded CUG repeat RNA (CUGexp RNA) is retained in the nucleus where it forms RNA foci leading to defects in regulated alternative splicing events during development. However, if the development of CUG expanded repeat RNA foci could be prevented, the disorder will not materialize. Manning et al. used the antisense BNA gapmer strategy to degrade CUG expanded repeat (CUGexp) RNA in immortalized human TeloMyoD fibroblast cell lines expressing telomerase and containing a tetracycline-inducible MyoD to promote the myogenic program in response to growth. Visualization of RNA was achieved using a FISH probe targeting the repeat RNA of the RNA foci in the untreated and treated cells.

    BNANC gapmers targeting within the repetitive region of DMPK preferentially degrade the mutant allele thereby decreasing RNA foci. Manning et al. were able to show that antisense BNANC gapmers could be used to potentially revert splicing defects in myotonic dystrophy type 1 (DM1) cells.

    Reference

    BNA Gapmers

    Daguenet E, Dujardin G, Valcárcel J. The pathogenicity of splicing defects: mechanistic insights into pre-mRNA processing inform novel therapeutic approaches. EMBO Rep. 2015;16(12):1640-55.

    Manning KS, Rao AN, Castro M, Cooper TA. BNANC Gapmers Revert Splicing and Reduce RNA Foci with Low Toxicity in Myotonic Dystrophy Cells. ACS Chem Biol. 2017;12(10):2503-2509. 

    Antisense BNA-Peptide Conjugates

    Antisense BNA/DNA-peptide-conjugates allow the treatment of drug-resistant infections.

    The opportunistic patogen, Acinetobacter baumannii, primarily found in hospital-acquired infections has developed multi-resistance. The presence of the aac(6’ )-Ib gene give the pathogen resistance to amikacin and other aminoglycosides wich severely limits the effectiveness of these antibiotics.

    Lopez et al. designed an antisense oligodeoxynucleotide (ODN4) that binds to a duplicated sequence on the aac(6’)-Ib mRNA, overlapping the initiation codon, which efficiently inhibited translation in vitro. A nuclease-resistant hybrid oligomer composed of 2’, 4’ -bridge nucleic acid-NC(BNANC) residues and deoxynucleotides (BNA-NC/DNA) conjugated to the permeabilizing cell-penetrating peptide (RXR)4XB (CPPBD4) inhibited translation in vitro at the same levels observed when testing ODN4.

    Reference

    Lopez, Christina, Arivett, Brock A., Actis, Luis A., and Tolmasky, Marcelo E.; Inhibition of AAC(6’)-Ib-Mediated Resistance to Amikacin in Acinetobacter baumannii by an Antisense Peptide-Conjugated 2’ ,4’ -Bridge Nucleic Acid-NC (BNA-NC)/DNA Hybrid Oligomer. doi:10.1128/AAC.01304-15. Antimicrobial Agents and Chemotherapy.

    CRISPR-Cas9 based Gene-Editing = CRISPR-BNAs

    Adding BNAs (2′,4′-BNANC[N-Me]) to CRISPR-RNAs (crRNAs) dramatically improves the accuracy in CRISPR-based gene-editing. The replacement of natural crRNA molecules with synthetic crRNAs containing bridged nucleic acids, or BNAs, enhances the binding affinity to crRNAs.

    Off-target effects or off-target cutting and the generation of additional mutations remain a significant barrier for using Cas9-based gene editing methods. BNA modified crRNAs improve the specificity of the CRISPR-Cas9 system and illustrate the power of recently developed synthetic nucleic acid technologies to solve problems in enzyme specificity as well.

    Reference

    Cromwell, Christopher R., Sung, Keewon, Park, Jinho, Krysler, Amanda R., Jovel, Juan, Kim, Seong Keun, and Hubbard, Basil P.; 2018. Incorporation of bridged nucleic acids into CRISPR RNAs improves Cas9 endonuclease specificity. Nature Communications 9, 1448.

    BNAs as Molecular Tools

    Molecular diagnostics is essential for drug development. Therefore, molecular tools are needed for identifying infections, screening of cancer or tumors, hepatitis, genetic disorders, and tissue screening to minimize the risks of tissue rejection.

    Also, to allow utilization of available sequence information from genomic data efficiently, molecular tools are needed for the investigation of the molecular biology governing metabolic pathways in various species, including humans. Molecular diagnostic tools are particularly valuable for the detection of bacterial bloodstream infections. BNAs lend themselves as building blogs for the development of next-generation molecular tools.

    BNAs as molecular tools.

    Molecular diagnostic tools for bacterial bloodstream infections.

    Tools for RNA targeting.

    Genomic and Proteomic Tools.


    Reference

    Jean Pierre Rutanga and Therese Nyirahabimana, “Clinical Significance of Molecular Diagnostic Tools for Bacterial Bloodstream Infections: A Systematic Review,” Interdisciplinary Perspectives on Infectious Diseases, vol. 2016, Article ID 6412085, 10 pages, 2016. https://doi.org/10.1155/2016/6412085.



    N6-methyladenosine (m6A) Analysis

    Insertion of bridged nucleic acids (BNAs) into DNA probes increases the difference in melting temperature between N6-methyladenosine (m6A)-containing RNA and unmethylated RNA. This approach allows quantification of methylation efficiency at m6A in RNAs with high accuracy.



    Inserting bridged nucleic acids (BNAs) into oligonucleotide probes increase the melting temperature (Tm) of the probes leading to an increase of the delta Tm (Δ Tm) between m6A-containing RNA and unmethylated RNA as compared with DNA probes. 

    Reference

    Oshima T , Ishiguro K , Suzuki T , Kawahara Y .; Quantification of methylation efficiency at a specific N6-methyladenosine position in rRNA by using BNA probes. Chem Commun (Camb). 2018 Aug 23;54(69):9627-9630. doi: 10.1039/c8cc03713b.

    Rapid Mutation Detection with BNAs


    The enzyme DNA methyltransferase 3A (DNMT3A) methylates DNA by catalyzing the transfer of methyl groups to specific CpG regions in DNA. DNMT3A is point mutated in many myeloid malignancies, but the mutation frequency varies between different entities. For example, in adult acute myeloid leukemia (AML) DNMT3A mutations are found in 14–34% of cases from different series, 5–15% of MDS cases, 10% of chronic myelomonocytic leukemia (CMML) patients, 5.7% of primary myelofibrosis (PMF) patients, 12% of cases with systemic mastocytosis, and in approximately 18% of T cell acute lymphoblastic leukemia (T-ALL) cases.

    Shivarov et al. in 2014 showed for the first time that BNA(NC)-modified probes can be used for the quantitative detection of DNMT3A R882 mutations using bead-based suspension assays. This assay can be successfully implemented in the diagnostics for patients with myeloid malignancies, as it is rapid, and reliable regarding specificity and sensitivity.

    Reference

    Shivarov V, Ivanova M, Naumova E (2014) Rapid Detection of DNMT3A R882 Mutations in Hematologic Malignancies Using a Novel Bead-Based Suspension Assay with BNA(NC) Probes. PLoS ONE 9(6): e99769. https://doi.org/10.1371/journal.pone.0099769.


    .


    0 0

    Incorporation of EdU or 5-ethynyl-2′-deoxyuridine allows the sensitive detection of DNA synthesis in cells using “click chemistry."

    In 2008, Salic and Mitchinson reported the EdU based method for a fast and sensitive detection of DNA synthesis in vivo.  No sample fixation or DNA denaturation is required and biological structures are preserved as well.

    As reported, the process works in cultured cells, the intestine, and brain of whole animals in which the cells incorporate 5-ethynyl-2'-deoxyuridine (EdU) into replicating DNA. After incorporation, the terminal alkyne group is available for the reaction with organic azides using Cu(I)-catalyzed click reactions.



    Figure 1: Schematics of the copper (I) catalyzed click chemistry.


    Salic and Mitchinson found that EdU incorporated into the DNA of proliferating mammalian cells, for example, into DNA replicated in vitro in Xenopus egg extracts by addition to the cycling extract preparations. 
    Varying ascorbic acid and fluorescent azide concentrations allow controlling the amount of the fluorescent signal generated during EdU detection.

    Salic and Mitchinson also indicate that the EdU-labeling method is well suited for optical imaging of cellular DNA at a nanometer resolution.

    The availability of the 5-Ethynyl-dU-CE Phosphoramidite also allows incorporation of EdU into  DNA during solid phase synthesis.

    Reference

    Salic, Adrian & Mitchison, Timothy J.; A chemical method for fast and sensitive detection of DNA synthesis in vivo. Proc Natl Acad Sci USA 2008 105 (7) 2415 – 2420.
    http://www.pnas.org/content/105/7/2415.abstract


    0 0

    RNAi using 2’,4’-BNANC[NH] nucleic acid analogues


    RNA interference (RNAi) or gene silencing by double-stranded RNA, was discovered in 1998 and in 2006 the Nobel Prize in Physiology or Medicine was awarded to Andrew Z. Fire and Craig C. Mello for this discovery. Since then it has emerged as a vital and powerful molecular biological tool for the regulation of gene expression and is now considered to have enormous potential for the treatment of a range of diseases. Since advancements in bioengineering and nanotechnology have led to improved control of delivery and release of siRNA therapeutics, several RNAi-based therapeutics are now in Phase II and Phase III clinical trials.

    RNAi is thought to be a natural defense mechanism that has evolved for the protection of organisms from RNA viruses. Cells can recognize double-stranded RNA (dsRNA) as an intruder. When this happens, the enzyme Dicer is recruited to cut the foreign RNA into smaller pieces called siRNA. These RNA pieces consist of approximately 22 nucleotides in length. One strand of the siRNA then binds to a target viral mRNA in a sequence-specific manner creating a signal for the destruction of the mRNA. The result is the interference with the further production of the viral proteins needed for a virus to replicate so that the RNA interference mechanism interferes with the expression of a particular gene that shares a sequence with the dsRNA that is homologous to that gene. 

    Mechanism of RNA interference.


    RNAi technologies utilize short double-stranded RNA (dsRNA) of approximately 21 base pair length with a two nucleotide (nt) 3’-overhang for the silencing of genes. These dsRNAs are generally called small interfering RNA (siRNA). siRNA 12 to 22 nucleotides in length are the active agent in RNAi. The siRNA duplex serves as a guide for mRNA degradation. Upon siRNA incorporation into the RNA-induced silencing complex (RISC) the complex interacts with a specific mRNA and ultimately suppresses the mRNA signal. The sense strand or passenger strand of siRNA is typically cleaved at the 9th nucleotide downstream from the 5’-end of the sense strand by Argonaute 2 (Ago2) endonuclease. The activated RISC complex containing the antisense strand or guide strand binds to the target mRNA through Watson–Crick base pairing causing degradation or translational blocking of the targeted RNA.

    However, the in-vivo use of RNAi or siRNA as a drug has remained difficult due to obstacles encountered such as low biostability and unacceptable toxicity possibly caused by off-target effects. Various types of chemical modifications to improve the pharmacokinetics and to overcome bio-instability problems have been investigated over the years to improve the stability and specificity of the RNAi duplexes. In some cases, the chemical modification in siRNAs has improved the serum stability of siRNAs. However, often RNAi activity was lost, but the careful placement of some specific modified residues enables enhanced siRNA biostability without loss of siRNA potency. Some of these particular modifications have reduced siRNA side effects, such as the induction of recipient immune responses and inherent off-targeting effects and have even enhanced siRNA potency. Various chemically modified siRNAs have been investigated, among them were bridged nucleic acids such as 2’,4’-methylene bridged nucleic acid 2’,4’-BNAs, also known as locked nucleic acid or LNA. Some of these modified siRNAs showed promising effects.

    BNA nucleic acid analogues are useful tools for gene silencing using RNAi


    Rahman et al. in 2010 investigated the effect of both 2’,4’-BNA and 2’,4’-BNA-NC modifications in gene silencing experiments using RNAi technology.

    The scientists observed that 2’,4’-BNAs (LNAs) and 2’,4’-BNA-NCs are equally effective in RNAi activity if incorporated appropriately, especially in the sense strand of siRNA.

    Design examples of BNA nucleic acid analogs useful for gene silencing by RNAi to inhibit the expression of firefly luciferase in CHO-luc cells. Modifications of the sense strand consecutively up to five BNA residues might be tolerable.

    Native sense strand:

     

    5’-CTTACGCUGAGUACUUCGATT-3’ 

     

    Native antisense strand:

     

    3’-TTGAAUGCGACUCAUGAAGCU-5’

     

    Duplexes formed:

     

      5’-CTTACGCUGAGUACUUCGATT-3’

    3’-TTGAAUGCGACUCAUGAAGCU-5’

      5’-GCUGAGUACUUCGAAAUGUTT-3’

    3’-TTCGACUCAUGAAGCUUUACA-5’     

    21mers




    For the identification of the best modification, Rahman et al. investigated a range of BNAs for their ability to inhibit firefly luciferase expression in CHO-luc cells. 
    Rahman et al. found that the introduction of 2’,4’-BNA modifications at 3’-overhangs in the sense and antisense strands of the siRNA (siBNA1 and 2) completely retained the natural RNAi property of natural RNA.

    Modifications with BNAs that worked the best

     

      5’-CTTACGCUGAGUACUUCGATT-3’ Tm = 83 °CSense Strand

    3’-TTGAAUGCGACUCAUGAAGCU-5’           Antisense Strand



     

      5’-CTTACGCUGAGUACTUCGATT-3’ Tm = 87 °C

    3’-TTGAAUGCGACUCAUGAAGCU-5’

     

      5’-CTTACGCUGAGTACTUCGATT-3’ Tm = 86 °C

    3’-TTGAAUGCGACUCAUGAAGCU-5’

     

      5’-GCTGAGTACUTCGAAAUGTTT-3’ Tm = 86 °C

    3’-TTCGACUCAUGAAGCUUUACA-5’

     

      5’-GCTGAGTACUUCGAAATGUTT-3’ Tm = 86 °C

    3’-TTCGACUCAUGAAGCUUUACA-5’

     

    Design Rules


    The design rules or guidlines for the design of highly effective RNAi indicate that dsRNA used for RNAi should follow the following four design parts at the same time:

    (i)     A/U at the 5’-end of the antisense strand,

    (ii)    G/C at the 5’-end of the sense strand,

    (iii)   AU-richness in the 5’-terminal third of the antisense strand, and

    (iv)   Absence of any GC stretch over 9 base pairs in length. (See figure below).

    (v)    Incorporation of BNAs at strategic positions.


    These guidelines appear related to the molecular mechanism of RISC assembly as reported by Ui-Tei et al. in 2004. The first three guidelines together with adding BNAs to the sense strand may allow the 5’-end of the antisense strand of siRNA to be situated at or near the thermodynamically less stable siRNA duplex end. 

    Structures of highly effective siRNA





    Please also review the following papers for more details.


    Reference


    Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC.; Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
    Nature. 1998 Feb 19;391(6669):806-11.

    S. M. Abdur Rahman, Hiroyuki Sato, Naoto Tsuda, Sunao Haitani, Keisuke Narukawa, 

    Takeshi Imanishi, Satoshi Obika; RNA interference with 2’,4’-bridged nucleic acid analogues. Bioorganic & Medicinal Chemistry 18 (2010) 3474-3480. 

    http://www.biosyn.com/Images/ArticleImages/pdf/RNA-interference-with-2-4-bridged-nucleic-acid-analogues.pdfhttps://www.ncbi.nlm.nih.gov/pubmed/20427190

    RNAi: RISC Gets Loaded


    Ui-Tei,K., Naito,Y., Takahashi,F., Haraguchi,T., Ohki-Hamazaki,H., Juni,A., Ueda,R. and Saigo,K. (2004) Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. Nucleic Acids Res., 32, 936–948.


    ---...---


    0 0

    In DrosophilaA’-form RNA helices drive microtubule-based mRNA transport

    A cell uses microtubule-based mRNA transport to restrict protein expression to a specific location within the cell. The exact location of proteins in cells defines cell polarity, axis determination, and neuronal function. RNA localization coupled to translational repression creates structural and functional asymmetry within cells. Cytoskeletal elements such as microtubules and actin filaments associated with mechanoenzymes mediate the transport of a significant fraction of transcripts. The best-studied model systems of RNA localization are the oocyte and the early embryo in Drosophila melanogaster.

    In eukaryotes, asymmetric localization of mRNAs plays widespread roles in protein targeting important for cellular processes such as patterning of embryonic axes, polarized cell functions, and synaptic plasticity. To understand the structural basis of recognition of cis-acting mRNA location signals by motor complexes Bullock et al. in 2010 used NMR spectroscopy for the determination of the tertiary structure of an RNA element responsible for mRNA transport. 

    Figure 1: Surface model of the solution structure of K10 TLS RNA.

    According to Bullock et al. the K10 TLS RNA adopts a stem-loop structure capped by an octanucleotide loop (5′-A(18)UUAAUUC(25)-3′) displaying a compact fold. The helical part of the TLS can consist of three regions: an upper helix composed of seven Watson-Crick A-U or U-A base pairs, a middle helix of three Watson-Crick base pairs, flanked at each end by single nucleotide bulges on the 3′ side, and a lower helix consisting of a G-U and six Watson-Crick base pairs. The two unpaired bases adopt different orientations relative to the helices, and the base moiety of C33 resides in the major groove maintains the helical twist between the adjacent base pairs. The base of A37 is stacked in between the middle and the lower helix and increases the helical twist between the adjacent base pairs.



    Knowing the structure of this RNA molecule adds to our understanding of cis-acting mRNA localization signals by
    molecular motor complexes. The K10 transport localization element is a regulatory element considing of 44 nucleotides. This RNA structure is responsible for the transport and anterior localization of k10 mRNA in the oocyte in which it establishes dorsoventral polarity

    For the study of molecular principles of mRNA localization, important developmental transcripts are delivered to the minus-ends of microtubules during early Drosophila development. The localization process is dynein-dependent and microinjection of in vitro synthesized fluorescent transcripts allow their study. Already several minus-end-directed transport signals have been mapped in Drosophila mRNAs. These RNA signals are all predicted to adopt stem-loop structures containing ~ 40-65 nucleotides (nt). However, they do not necessarily share primary sequences or any obvious RNA motifs. However, at present, it is not clear which features within mRNAs are recognized by the transport machinery. More studies will be needed to elucidate the molecular mechanisms involved in mRNA localization. 

    Reference

    Bullock SL, Ringel I, Ish-Horowicz D, Lukavsky PJ. A'-form RNA helices are required for cytoplasmic mRNA transport in Drosophila. Nat Struct Mol Biol. 2010;17(6):703-9. 

    ---...---



    0 0

    In organisms, genetic mutations can arise in fertilized eggs as well as in subsets of cells. Somatic mosaicism refers to the presence of two genetically distinct populations of cells within an individual originating from postzygotic mutations. In humans, these somatic mutations are not transmitted to children but can affect different genomic sizes ranging from single nucleotides to entire chromosomes. Medical researchers now think that somatic mosaicism can cause cancer, neurodegenerative, as well as monogenic, and complex diseases.

    Figure 1. C99. C99 is the transmembrane carboxyl-domain of the amyloid precursor protein (APP) cleavaged by ϒ-secretase releasing amyloid-beta polypeptides (Barrett et al. 2012). 



    Recently, several reports have shown that individual neurons of the brain can display somatic genomic mosaicism. Bushman et al., in 2015, reported that Alzheimer’s disease neurons show increases in DNA content and amyloid precursor protein (APP) gene copy numbers.
    Alzheimer’s currently afflicts more than 20 million people worldwide.

    Bushman et al. found that neurons from people with sporadic Alzheimer’s disease contained more DNA and had more copies of the Alzheimer-related gene APP than neurons from people without the disease. More recently, the analysis of APP variants by Lee et al., in 2018, revealed the presence of many APP mRNA variants in neurons from Alzheimer patients. Detailed analysis showed that many variants lacked introns leaving only protein-coding exons. Also, these variants were shorter than expected and contained single-nucleotide mutations, inserted and deleted exons as well as larger deletions. Larger deletions appear to lead to the formation of new exon-exon junctions between missing multi-exon regions.



    Furthermore, the same short variants are found in genomic DNA of neurons. These findings suggested that the APP-variant mRNA may have been transcribed from matching genomic DNA sequences (gencDNAs), which are now permanently embedded in the genomes of neurons. For the validation of these findings, DNA in situ hybridization (DISH) together with sequencing short sections of APP DNA was used to verify their presence.

    To conclude, this study revealed the existence of a phenomenon called somatic recombination in the brain. Somatic recombination increases the diversity of proteins encoded by a given gene through DNA-shuffling mechanisms. However, the precise physiological function of APP is presently not known, and more molecular studies are needed to solve the nature of this mechanism to gain answers that allow the development of therapies for Alzheimer’s disease. 

    Reference



    Barrett PJ, Song Y, Van Horn WD, et al. The amyloid precursor protein has a flexible transmembrane domain and binds cholesterol. Science. 2012;336(6085):1168-71.



    Bushman DM, Kaeser GE, Siddoway B, et al. Genomic mosaicism with increased amyloid precursor protein (APP) gene copy number in single neurons from sporadic Alzheimer's disease brains. Elife. 2015;4:e05116. Published 2015 Feb 4. doi:10.7554/eLife.05116.



    Freed D, Stevens EL, Pevsner J. Somatic mosaicism in the human genome. Genes (Basel). 2014;5(4):1064-94. Published 2014 Dec 11. doi:10.3390/genes5041064.

    Larracuente, A. M., & Ferree, P. M. (2015). Simple method for fluorescence DNA in situ hybridization to squashed chromosomes. Journal of visualized experiments : JoVE, (95), 52288. doi:10.3791/52288.

    Lee, Ming-Hsiang, Siddoway, Benjamin, Kaeser, Gwendolyn E., Segota, Igor, Rivera, Richard, Romanow, William J., Liu, Christine S., Park, Chris, Kennedy, Grace, Long, Tao, Chun, Jerold; Somatic APP gene recombination in Alzheimer’s disease and normal neurons. Nature 2018, 563, 639-645. 

    O'Brien RJ, Wong PC. Amyloid precursor protein processing and Alzheimer's disease. Annu Rev Neurosci. 2011;34:185-204. 

    Peptides for neuroscience research: 
    http://www.biosyn.com/Newsletters/Neurodegenerative-diseases.html

    ---...---


    0 0

    The Hepatitis B virus (HBV) causes liver infection, but for some people, it is just an acute or short-term infection, however, for others, it can become a long-term, chronic infection called chronic hepatitis.


    Chronic Hepatitis B can lead to serious health issues. Vaccination against HBV is the best way to prevent infections with HBV. However, infections with HBV remain a top health problem worldwide. In 2013 alone, HBV infections caused approximately 600,000 deaths. According to Papastergiou et al., more than 350 million people are chronically infected with HBV.

    Detection and measurements of HBV DNA levels are now routinely used for the identification of infectious, chronic carriers and the prediction and monitoring of efficacies of antiviral treatment.


    Real-time PCR (RT PCR) is now widely accepted as the gold standard for quantification of viral nucleic acids. RT PCR allows quantification of HBV DNA with improved speed of detection, high sensitivity, and reproducibility, as well as a low risk of contamination. Several real-time PCR assays have been developed usually using two pairs of primers and probes often based on the conserved S and C regions of the HBV genome.

    Primers used for the amplification of HBV complete genomes 
     

    Primera

    Sequence (5′–3′)

    Position (nt)b

    Amplicon (bp)

    Sequencing primer

    PR1a

    (Ta = 4°C)

         

    251F

    GACTYGTGGTGGACTTCTC

    251–269

    940

    Yes

    1190R

    TCAGCAAAYACTYGGCA

    1190–1174

     

    Yes

    PR1b

    (Ta = 54°C)

         

    595F

    CACHTGTATTCCCATCCCA

    595–613

    1,203

    Yes

    1797R

    CCAATTTMTGCYTACAGCCTC

    1797–1777

     

    No

    1190F

    AYGCAACCCCCACTGG

    1190–1205

     

    Yes

    PR 2a

    (Ta = 50°C)

         

    2300F

    CCACMWAATGCCCCTATC

    2300–2317

    1,131

    Yes

    215R

    AGRAAMACMCCGCCTGT

    215–200

     

    Yes

    PR 2b

    (Ta = 50°C)

         

    2819F

    ACCWTATWCYTGGGAACAA

    2819–2837

    1,032

    Yes

    617Rc

    GAYGAYGGGATGGGAATACA

    617–598

     

    Yes

    654R

    GSCCCAMBCCCATAGG

    652–637

     

    No

    PR 3

    (Ta = 52°C)

         

    1859F

    ACTNTTCAAGCCTCCRAGCTG

    1859–1879

    959

    No

    1877F

    CTGTGCCTTGGRTGGCTT

    1894–1877

     

    Yes

    2835R

    GTTCCCAVGWATAWGGTGAYCC

    2835–2814

     

    Yes

    PR 4

    (Ta = 57°C)

         

    1584F

    ACTTCGMBTCACCTCTGCACGT

    1583–1604

    748

    No

    2331R

    GGAAGYGTKGAYARGATAGGGGCATT

    2331–2306

     

    Yes

    2396R

    GTCKGCGAGGYGAGGGAGTT

    2396–2377

     

    No



    aSuffix “F” indicates forward primer, whereas suffix “R” indicates reverse primer.

    bWith reference to NC_003977. https://www.ncbi.nlm.nih.gov/nuccore/NC_003977Hepatitis B virus (strain ayw) genome

    cAn annealing temperature of 54°C was used during sequencing cycling to ensure a high rate of success of sequencing.


    BNA Primers and Probes


    Artificial nucleic acids such as bridged nucleic acids (BNAs) can also be incorporated into oligonucleotide probes to increase sensitivity and selectivity of the probes.

     

    Primer

    Probes

    Sequence

    Bases

    Tm (°C)

     

     

     

     

    P1

    GACCACCAAATGCCCCTAT

    19

    55

    P2

    CCRAGAYYGAGATCTTCTGCGAC

    23

    53

    BNA probe

    FAM-TCGTCTAACAACAGT-BHQ1

     

     

    TaqMan

    FAM-TCGTCTAACAACAGT(TAMMRA)AGTTTCCGGAAGTGT-P

     

     

     

    aThe underlined nucleotides indicate a BNA monomer substitution. Tm, temperature; BNA, bridged nucleic acid (e.g. BNA or LNA) ; HBV, hepatitis B virus; PCR, polymerase chain reaction. (Source: Wang et al. 2011.)  https://www.cdc.gov/hepatitis/hbv/index.htm

     

    More primers and probe sequences for the S and C regions.

     

    Primer and Probe

    Sequence (5′-3′)

    S-F

    GATGTGTCTGCGGCGTTTTA

    S-R

    GCAACATACCTTGATAGTCCAGAAGAA

    S-P

    Vic-CCTCTICATCCTGCTGCTATGCCTCA-BHQ1

    C-F

    TTCCGGAAACTACTGTTGTTAGAC

    C-R

    ATTGAGATTCCCGAGATTGAGA

    C-P

    Fam-CCCTAGAAGAAGAACTCCCTCGCCTC-BHQ1

    Sa-F

    TCGTGTTACAGGCGGGGTTT

    Sa-R

    GGCACTAGTAAACTGAGCCA

    Ca-F

    CCTACTGTTCAAGCCTCCAA

    Ca-R

    AATGTCCTCCTGTAAATGAATGT

     

     

    Reference

    Chao Liu, Le Chang, Tingting Jia, Fei Guo, Lu Zhang, Huimin Ji, Junpeng Zhao and Lunan Wang; Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.Virology Journal201714:94. https://doi.org/10.1186/s12985-017-0759-8.

    Chook, J. B., Teo, W. L., Ngeow, Y. F., Tee, K. K., Ng, K. P., & Mohamed, R. (2015). Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G. Journal of clinical microbiology, 53(6), 1831-5. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4432068/

    Hepatitis B Info:

    https://health.mil/Military-Health-Topics/Health-Readiness/Immunization-Healthcare/Vaccine-Preventable-Diseases/Hepatitis-B
    http://www.medsci.org/v08p0321.htm
    https://virologyj.biomedcentral.com/articles/10.1186/s12985-017-0759-8

    Papastergiou, V., Lombardi, R., MacDonald, D. et al. Global Epidemiology of Hepatitis B Virus (HBV) Infection. Curr Hepatology Rep (2015) 14: 171. https://doi.org/10.1007/s11901-015-0269-3. https://link.springer.com/article/10.1007%2Fs11901-015-0269-3

    Wang, Q., Wang, X., Zhang, J., & Song, G. (2011). LNA real-time PCR probe quantification of hepatitis B virus DNA. Experimental and therapeutic medicine, 3(3), 503-508. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3438541/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3729363/
    ---...---