Neurodegeneration and Neurodegenerative Diseases

What do we fear the most when we age? Most of us will most like fear the degeneration of our brain power the most. I admit that symptoms like forgetting names or places that I know I knew annoys me a lot. Therefore neurodegenerative disorders are some of the most feared illnesses in our society.

Alzheimer’s disease affects up to 10% of people over 65 years of age. This disease causes the progressive loss of memory and other mental faculties, leaving the individual confused and incompetent to care for him- or herself. Huntington’s disease is another relatively common neurodegenerative disorder. One in ten thousand individuals are affected. People inflicted with this disease make involuntary movements and become serverely emotionally disturbed as well as cognitively impaired. Prion diseases, including Creutzfeldt-Jakob disease, lead to mental and physical decline followed by death.

Many scientists are working and have been working to find a treatment or cure, still, no successful treatments are yet available for any of this diseases but some progress has been made during recent years. Scientific research in this field aims to understand the disease mechanism in order to develop successful treatments and to prevent the onset of symptoms in patients. Particular genetic traits appear to be linked to many of these diseases. For example, the chromosome and gene linked to Huntington’s disease, Freiderich’s ataxia, the prion genes linked to spongiform encephalopathies, as well as the triplet repeat mutations responsible for myotonic dystrophy have all been identified. Model systems in which to test potential therapies and prevention strategies have been developed and are employed to find a cure for this cruel and distressing diseases.

Familiar neurodegenerative disorders are Alzheimer’s, Parkinson’s, Huntington’s and Wilson’s disorders. Table 1 shows a list of autosomal neurodegenerative diseases including what is known about chromosomal linkage, genes, mutations and pathology.

Table 1. Autosomal dominant primary neurodegenerative diseases. Ch, chromosome; PrP, prion protein; T, tangles; LB, Lewy bodies; 1, is present or exists; AD, Alzheimer’s disease; PD, Parkinson’s disease; HD, Huntington’s disease; SOD, superoxide dismutase.

Alzheimer's disease (AD) is the most common form of dementia among older people which is a brain disorder that seriously affects a person's ability to carry out daily activities. AD begins slowly, it first involves the parts of the brain that control thought, memory and language. Over time, symptoms get worse. People may not recognize family members or have trouble speaking, reading or writing. They may forget how to brush their teeth or comb their hair. Later on, they may become anxious or aggressive, or wander away from home. Eventually, they need total care. The disease usually begins after age 60 and the risk of getting it goes up with age. The risk is also higher if a family member has had the disease. No treatment can yet stop the disease.

Amyotrophic lateral sclerosis (ALS) is a disease that attacks nerve cells called neurons in the brain and spinal cord. The job of neurons is to transmit messages from the brain and spinal cord to voluntary muscles - the ones that control arms and legs. At first, this causes mild muscle problems, some people notice trouble when walking or running, writing and may notice speech problems. Eventually they lose strength and cannot move. When the muscles in the chest fail they cannot breathe. A ventilator may help, but most people with ALS die from respiratory failure. The disease usually strikes between age 40 and 60. More men than women get it. No one knows what causes ALS. It can run in families, but usually it strikes at random. There is no cure. Medicines can relieve symptoms and, sometimes, prolong survival.

Friedreich's ataxia is an inherited disease that damages the nervous system. It affects the spinal cord and the nerves that control muscle movement in arms and legs. Symptoms usually begin between the ages of 5 and 15. The main symptom is ataxia, which is trouble coordinating movements. Specific symptoms include difficulty to walk, muscle weakness, speech problems, involuntary eye movements, scoliosis and heart palpitations. People with Friedreich's ataxia usually need a wheelchair 15 to 20 years after symptoms first appear. In severe cases, people become incapacitated. There is no cure.

Huntington's disease (HD) is an inherited disease that causes certain nerve cells in the brain to waste away. People are born with the defective gene, but symptoms usually don't appear until middle age. Early symptoms of HD may include uncontrolled movements, clumsiness or balance problems. Later, HD can take away the ability to walk, talk or swallow. Some people stop recognizing family members. Others are aware of their environment and are able to express emotions. If one of the parents has Huntington's disease, there is a 50-50 chance of getting it. A blood test can tell if the HD gene is present and if there is a risk to develop the disease. There is no cure. Medicines can help manage some of the symptoms, but cannot slow down or stop the disease.

Lewy body disease is one of the most common causes of dementia in the elderly that causes a loss of mental functions severe enough to affect normal activities and relationships. Lewy body disease happens when abnormal structures, called Lewy bodies, build up in areas of the brain. The disease may cause a wide range of symptoms, including changes in alertness and attention, hallucinations, problems with movement and posture, muscle stiffness, confusion and finally loss of memory. Lewy body disease can be hard to diagnose since it can be confused with Parkinson’s and Alzheimer’s disease. The disease usually begins between the ages of 50 and 85. The disease gets worse over time. There is no cure.

Parkinson's disease affects nerve cells, or neurons, in a part of the brain that controls muscle movement. In Parkinson's, neurons that make a chemical called dopamine die or do not work properly. Dopamine normally sends signals that help coordinate movements. Symptoms of Parkinson's disease may include trembling of hands, arms, legs, jaw and face, stiffness of the arms, legs and trunks, slowness of movement, poor balance and coordination. Parkinson's usually begins around age 60 but can start earlier. It is more common in men than in women. There is no cure for Parkinson's disease.

Spinal muscular atrophy (SMA) attacks nerve cells, called motor neurons, in the spinal cord. These neurons communicate with voluntary muscles. As neurons are lost muscles weaken. This can affect walking, crawling, breathing, swallowing and head and neck control. SMA runs in families. Parents usually have no symptoms, but still carry the gene. There are many types of SMA, and some of them are fatal. Life expectancy depends on the type of disease.

Spinocerebellar ataxia (SCA) a progressive and degenerative genetic disease containes multiple types, each of which could be considered a disease in its own right. The following is a list of some, not all, types of Spinocerebellar ataxia. The first ataxia gene was identified in 1993 for a dominantly inherited type. It was called “Spinocerebellar ataxia type 1" (SCA1). Subsequently, as additional dominant genes were found they were called SCA2, SCA3, etc. Usually, the "type" number of "SCA" refers to the order in which the gene was found. At this time, there are at least 29 different gene mutations which have been found. Many SCAs below fall under the category of polyglutamine diseases, which are caused when a disease-associated protein (i.e. ataxin-1, ataxin-3, etc.) contains a glutamine repeat beyond a certain threshold. In most dominant polyglutamine diseases, the glutamine repeat threshold is approximately 35, except for SCA3 which is beyond 50. Polyglutamine diseases are also known as "CAG Triplet Repeat Disorders" because CAG is the codon which codes for the amino acid glutamine. Many prefer to refer to these also as polyQ diseases since "Q" is the one-letter reference for glutamine.

Spinal and bulbar muscular atrophy (SBMA), also known as spinobulbar muscular atrophy, X-linked bulbo-spinal atrophy, X-linked spinal muscular atrophy type 1 (SMAX1) and Kennedy's disease (KD)— A X-linked, recessive, slow progressing, neurodegenerative disease associated with mutations of the androgen receptor (AR) gene resulting in the impairment of the AR that can be viewed as a variation of the disorders of the androgen insensitivity syndrome (AIS).

Dentatorubral-pallidoluysian atrophy (DRPLA) is an autosomal dominant pinocerebellar degeneration caused by an expansion of a CAG repeat encoding a polyglutamine tract in the atrophin-1 protein. It is also known as Haw River Syndrome and Naito-Oyanagi disease. Although this condition was perhaps first described by Smith et al. in 1958, and several sporadic cases have been reported from Western countries, this disorder seems to be very rare except in Japan.

There are at least eight neurodegenerative diseases that are caused by expanded CAG repeats encoding polyglutamine (polyQ) stretches. The expanded CAG repeats create an adverse gain-of-function mutation in the gene products. Of these diseases, DRPLA is most similar to Huntington disease.

References
 

Amino Acid Analysis

The analysis of free amino acids present in food samples, body fluids such as urine, serum and blood, and other sources, amino acid hydrolysates, from proteins, or primary and secondary amines is an important, standardized method routinely performed in biochemical, medical and biological labs. It has been, and still is used for the accurate quantification and characterization of proteins and peptides, as well as recombinant gene products. It is considered the method of choice to determine the purity and chemical composition of a protein or peptide.

1. Types of amino acid analyses

A. Hydrolysate analyses

Composition studies: Determination of amino acid content of proteins, peptides, foods, beverages, cosmetics, and others.
Quality control:             Verification of product composition

B. Physiological analyses

Nutrition studies:       Determination of free amino acid content in food supplements, and others.
Clinical assays:         Determination of amino acid content in serum, tissue, and other body fluids.

     Amino acid analysis (AAA) is a method for breaking down a protein or peptide into its components (amino acids) and determining their identities and relative quantities of the freed amino acids. Absolute quantities of amino acids released from the protein or peptide can also be determined.

     AAA can be used in combination with protein sequence analysis to verify if the total sequence of the protein in question has been determined. It also helps to identify modified amino acids like phosphor-tyrosine, the presence of amino acids modified with carbohydrates, if amino sugars are found, and others.

     Knowledge of the number of methionines or tryptophanes present allows for the design of peptide mapping strategies employing enzymatic or chemical cleavage methods to generate a limited number of longer peptides. These peptides may then be sequenced and used for the design of primers. Knowledge of the number of Lys, Arg, Asp, and Glu residues allows one to select the most appropriate protease for further experiments.

     Even today, AAA is still the most practical method for accurately quantifying amino acid, peptide and protein concentrations. Accurate measurements are essential for calculating extinction coefficients of proteins or to determine the turnover number for an enzyme. Although instrumentation performance has improved over the years, the basic concepts of amino acid analysis have not changed since Stein and Moore (1963) developed the original method based on ion exchange resins.

2. Sample preparation

     The preparation of samples to be used in AAA can be a quite difficult but very important experimental step for a successful amino acid analysis. Contamination with other proteins, amino acids, and other molecular weight solutes that interfere with the analysis chemistry are the most serious. To get accurate results the purity of the sample is much more critical than for sequencing or mass analysis.

2.1. Contamination with traces of undesired proteins:

     In the case of proteins a 10% contamination of the desired protein with an undesired byproduct such as a different protein may render the data useless.

2.2. Low molecular weight compounds

     Compounds containing primary or secondary amino groups are a very serious problem. They can be found in abundance in every laboratory and are difficult to completely eliminate. Tris and glycine are two good examples. Contamination is the major factor limiting increases in the sensitivity of analysis. The rule of thumb here is: the more steps used prior to analysis the more contamination one can pick up.

2.3. Non-amines

Non-amine compounds including many buffers, detergents, and inorganic salts, especially high salt concentrations may interfere with the analysis and need to be removed prior to analysis.

2.4. Sample treatment for physiological samples

     Physiological samples need to be treated differently than proteins prior to loading on to the derivatizer unit. To avoid losses of labile amino acids present in the sample, keep sample solutions on ice and store in freezer below -20 ºC between use or better (if enough sample is at hand), prepare aliquots and store frozen in freezer prior to analysis.

Precipitation of proteins with 5-sulfocalicylic acid (SSA):Human urine, serum and rat brain tissue extracts are treated with sulfosalicylic acid to precipitate protein: 20 µl of 35% sulfosalicylic acid is added to 200 µl of each sample.  These solutions are vortexed and allowed to sit at room temperature at least 20 minutes before proceeding.  The samples are then spun in a microfuge for 2 minutes and the supernatants are collected. Collagen samples are hydrolyzed in 6 N HCl, 110 oC for 24 hours.  The hydrolysates are then dried down and resuspended in 250 µg/ml K4EDTA.  Ant hemolymph does not need to be pretreated before analysis. Samples are loaded onto the analyzer as follows:  Urine - 10 µl of a 1:2 dilution of the supernatant, Serum - 10 µl of undiluted supernatant, Rat brain extract - 10 µl of the undiluted supernatant, Collagen hydrolysate - 1.2 µg in 15 µl,  Fire ant hemolymph - 4 µl of a 1:9 or 1:10 dilution. Our current knowledge that approximately 30,000 human genes appear to code for up to 1 million or more proteins has generated new interest in independent ‘de novo’ protein and peptide sequencing of gene products. Two methods are available for this task, the classical Edman chemistry based method, or the newer, more recent method which utilizes LC-MS/MS based sequencing. The second method is considered to be faster and more sensitive.

     When sufficient quantities are at hand, samples may be desalted by dialysis or size exclusion chromatography using deionized water or a volatile buffer like 1 N acetic acid. These two methods are not recommended to be used for quantities below 1 nanomole. Reversed phase-HPLC may be used for smaller sample quantities. But even this method can be tricky.

3. Hydrolysis methods

     The second part of the analysis is the hydrolysis process. Many methods have been investigated to ensure optimal recoveries for the different amino acids analyzed.

3a. Standard hydrolysis conditions are 6N HCl from 20 to 96 hours at 110 ºC in vacuo.

Limitations and recovery improving modifications of the method are listed below:

     Side chain hydroxyl group is modified during hydrolysis (eg. esterification, dehydration). Typical losses using standard hydrolysis conditions are 15-20% for serine and 10-15% for threonine.

     A typical method for quantitation is to run multiple hydrolyses at different hydrolysis times and plot the serine and threonine recovery versus length of hydrolysis (hydrolyzed for 30, 60 and 90 min). Extrapolate the recovery to time = 0 to yield an accurate quantitation.

•   Tyrosine

Table 2:     Derivatization Chemistries for Amino Acids and Amine Analysis

References

Bridged Nucleic Acids (BNAs) - BNA3

Beyond peptide nucleic acids (PNAs) and locked nucleic acids (LNAs)

The near completion of the human genome sequence in 2001 as well as the availability of whole genome sequences for many organisms in recent years has led to an exponential increase in genomic information in the last decade. The NIH website, http://www.ncbi.nlm.nih.gov/genome, contains a collection of sequences for partial or whole genomes, the number of which is constantly increasing at a high speed. This huge amount of sequence information provides a large source for the design of genetic tools to study molecular details of the genetic information flow in organisms. Scientific evidence shows that humans and other vertebrates are made up by close to or more than 220 different specialized cell types. Each cell type has its own gene regulatory network. To understand an organism at the molecular level the regulation of the genetic information flow will need to be studied. For this purpose new tools have been and are constantly developed. The double helix of DNA is nature’s solution to storing, retrieving, and communicating genetic information of a living organism. Two of many important characteristics of the DNA molecule are the specificity and the reversible nature of the hydrogen bonding between complementary nucleobases. These properties allow the DNA strands of the double helix to unwind and rewind in exactly the same configuration. It is now understood that the cell contains a vast collection of ‘nano-machines’ that control gene regulation. DNA, RNA, proteins, and other molecules make up these nano-assemblies. Control points for gene expression that are studied by scientists include transcriptional regulation, RNA processing, translational control, the stability of mRNA, posttranslational control, and DNA rearrangements among others. These regulatory systems found in prokaryotes and eukaryotes can differ from each other in many details. Once the nature of the DNA and RNA molecules was established the field of life science realized early on that if specific, single strands of DNA could be synthesized, scientist would be able to study and manipulate the gene sequences of DNA and RNA. This was realized with the development of efficient chemistries including automated instrumentation to allow for the synthesis of DNA and RNA monomers and polymers of increased size including their modifications. Oligonucleotide chemistry has been developed greatly over the past three decades and many advances have been made in the design of DNA, RNA and peptide based molecular tools with increased nuclease resistance.

The double helix exists in multiple conformations which were revealed by X-ray diffraction studies of concentrated DNA solutions that had been drawn out into thin fibers. Two kinds of structures, the B and the A forms of DNA were found. It is thought that the B form corresponds to the average structure of DNA under physiological conditions. Its structure has 10 base pairs per turn, and a wide major groove and a narrow minor groove. The A form on the other hand has 11 base pairs per turn and its major groove is narrower and much deeper than that of the B form. Furthermore, its minor groove is broader and shallower. The B DNA is found in the vast majority of the DNA in the cell. However, A DNA can be found in certain DNA-protein complexes. The non-covalent bonds in double stranded DNA (dsDNA) sequences are formed by Watson-Crick interactions. On the other hand, in triplex forming oligonucleotides the triplex forming strand binds to the duplex via Hoogsteen hydrogen interactions. Structures of the nucleotides and their interaction are shown in the following figure.

Structures of Watson-Crick-type base pairs, G•C and A•T (left), and Hoogsteen type base triads, C+•G•C and T•A•T (right).

The chemical structures for RNA and DNA are shown below as well as the structures for the A form of RNA and the B-form of DNA.

RNA contains ribose rather than 2’-deoxyribose in its backbone. The ribose has a hydroxyl group at the 2’-position. Furthermore, RNA contains the nucleic acid uracil in place of thymine and is usually found as a single polynucleotide chain. While RNA is typically single stranded, RNA chains can frequently fold back on themselves to form base-paired segments between short stretches of complementary sequences. The presence of 2’-hydroxyls in the RNA backbone favors a structure that resembles the A-form structure of DNA. The flexible five-membered furanose ring in nucleotides exists in equilibrium of two conformations of the N- and the S-type. A closer look at the two forms is shown as follows.

Synthetic oligonucleotides are now important, established tools for life scientists and have many applications in molecular biology, genetic diagnostics and are poised to become important tools in the emerging field of molecular medicine as well. While unmodified oligodeoxynucleotides can form DNA:DNA and DNA:RNA duplexes they are sometimes unstable and labile to nucleases. Therefore a variety of nucleic acid analogs have been developed to enhance high-affinity recognition of DNA and RNA targets, enhancing duplex stability and assist with cellular uptake. Among the list of these analogs are peptide nucleic acids (PNAs), 2’-fluoro N3-P5-phosphoamidites, 1’, 5’-anhydrohexitol nucleic acids (HNAs) and locked nucleic acids (LNAs) as well as other bridged nucleic acids (BNAs). Peptide nucleic acids (PNAs) are synthetic polymers that contain a peptide backbone and nucleic acid bases as side chains within their sequence. These polymers can form strong specific bonds with complementary sequences present in double-stranded DNA (dsDNA). 2’-fluoro N3-P5-phosphoamidites are modified nucleotide analogs that contain fluor in the 2’ position. Hexitol nucleic acids are oligonucleotides built up from natural nucleobases and a phosphorylated 1,5-anhydrohexitol backbone. Anhydrohexitol oligonucleotides can be synthesized using phosphoramidite chemistry and standard protecting groups. LNAs are structurally rigid oligo-nucleotides with increased binding affinities.

A bridged nucleic acid (BNA) is a molecule that can contain a five-membered or six-membered bridged structure. Ideally the bridge is synthetically incorporated at the 2’, 4’-position of the ribose to afford a 2’, 4’-BNA monomer. The monomers can be incorporated into the oligonucleotide polymer structure using standard phosphoamidite chemistry. The goal for the synthesis and use of BNAs is to generate oligonucleotides with (i) equal or higher binding affinity against an RNA complement with excellent single-mismatch discriminating power, (ii) much better RNA selective binding, (iii) stronger and more sequence selective triplex-forming characters, and (iv) with a pronounced higher nuclease resistance, even higher than S_p-phosphorthioate analogues, than regular DNA or RNA oligonucleotides.

Monomer structures of BNAs. The structures of selected nucleic acid analogs with a bridged sugar moiety are depicted.
 

While a large number of chemically modified oligonucleotides have been developed during the last few decades, most of these molecules have failed to give the desired response and the search for new molecules with better qualities still continues today. One dramatic improvement was made with the introduction of the bridged nucleic acid, 2’, 4’-BNA (also called LNA). The compound shows a better hybridization affinity for complementary strands, both for RNA and DNA strands, in comparison to unmodified nucleotides. Furthermore the BNA can be used to design sequence selective LNA-oligonucleotide hybrids that are soluble in aqueous solutions and exhibit improved biostability in comparison to natural nucleotides. This BNA monomer has now been widely used in nucleic-acid-based technologies. However, according to Imanishi’s group, there is a need for further development because the nuclease resistance of the LNA is significantly lower than that obtained by phosphorothioate oligonucleotide and the fact that oligonucleotides containing consecutive LNA units or a fully modified oligonucleotide using the analog are very rigid and inflexible. Furthermore, additional research has proven that a kind of LNA-modified antisense oligonucleotide is hepatotoxic.

The scientists Satoshi Obika, Daishu Nanbu, Yoshiyuki Hari, Ken-ichiro Morio, Yasuko In, Toshimasa Ishida, and Takeshi Imanishi in 1997 reported the synthesis of a 2’-O,4’-C-Methyleneneuridine and –cytidine, novel bicylic nucleosides with a fixed C³ - endo sugar puckering. One of these nucleoside analogs is now known as a “locked nucleotide” or LNA. In the ribofuranose, the plane C1’-O4’-C4’ is fixed. The C3’- endo conformation is found in RNA. DNA can adjust and is able to take on both conformations. The exact nomenclature of sugar puckers can be found at http://www.chem.qmul.ac.uk/iupac/misc/pnuc2.html

Obika et al. in 1998 (Imanishi’s research group) report the synthesis of bicyclic nucleoside analogues with a fixed N-type conformation, 2'-O,4'-C-methyleneuridine and –cytidine and the incorporated of this analogue into oligonucleotides. The binding efficiency of the modified oligonucleotides to the complementary DNA and RNA as well as the CD spectra of the modified DNA-DNA and modified DNA-RNA duplexes were studied.

Imanishi’s group has synthesized newer generations of BNAs with improved properties, one called 2’4’-BNA-COC, and more recently, one called 2’,4’-BNA-NC. To optimize the length of the bridging moiety the BNA-NC was designed to contain a six-membered bridged structure with an N-O bond in the sugar molecule. The next figures show the chemical structures and 3D ball-and-stick model for the three BNAs.

The chemical structures and the energy minimized molecular models for the 2’, 4’-BNA-NC[NH] and 2’, 4’-BNA-NC[NCH₃] monomers are illustrated here.
 

Hari et al. in 2003 developed a novel nucleoside analogue for the effective recognition of CG interruption in a homopurine–homopyrimidine tract of double-stranded DNA (dsDNA). The group succeeded to synthesize a triplex-forming oligonucleotide (TFO) containing a novel 2’,4’-BNA (QB) bearing 1-isoquinolone as a nucleobase. The group used this BNA to investigate the triplex-forming ability and sequence-selectivity of the TFO. Using melting temperature (T_M) measurements, it was found that the TFO-QB formed a stable triplex DNA in a highly sequence-selective manner under near physiological conditions.

Rahman et al. reported in 2007 that oligonucleotides containing 2’, 4’-BNA-NC monomers show an increase in their melting temperature (T_m) of 5.3 to 6.3 °C per modification (ΔT/mod) when investigated by UV melting experiments (T_m measurements).The melting temperature (T_m) is defined as the temperature at which half of the DNA strands are in the double-helical state and half are in the random coil state. The T_m depends on the length of the oligonucleotide molecule and its sequence. The T_m values of duplexes formed by 2’, 4’-BNA-NC[NH] oligonucleotides that contained three or more modifications are higher than those exhibited by the corresponding 2’, 4’-LNA modified oligonucleotides indicating a stronger binding and stability of the duplexes. Both 2’, 4’-BNA-NC[NH] and 2’, 4’-BNA-NC[NCH₃] display selective binding to RNA, superior to that of 2’, 4’-LNAs. The researchers used mismatch discrimination studies to evaluate their ability for selective hybridization. The presence of a mismatched base in the target RNA strand resulted in a substantial decrease in the T_m of the duplexes formed. The analysis of formed duplexes by circular dichroism (CD) verified the presence of the A-form by showing the spectra typical for this structure. The A-form of the helical structure is favored because of the conformational restriction of the sugar moiety to the N-form. Furthermore, the BNAs can form triplexes with a higher stability compared to that of LNAs. Applications in antigenic and gene repair technologies require the formation of stable triplexes at physiological pH. Next, to test the BNAs for their resistance to nucleases oligonucleotides [5’-d(TTTTTTTTTT)-3’] modified with a single 2, 4’-BNA-NC unit were incubated with a 3’-exonuclease (Crotalus adamanteus venom phosphodiesterase, CAVP, Pharmacia) at 37 °C and the amount of intact oligonucleotides remaining were evaluated by RP-HPLC. The results showed that oligonucleotides modified with BNA-NC[NMe] are much more resistant to degradation than LNA modified oligonucleotides.

Rahman et al. in 2007 report on the use of BNA analogues to allow the formation of highly stable pyrimidine-motif triplexes at physiological pH. The formation of a stable triplex DNA molecule at physiological pH values is a highly desirable phenomenon in molecular biology and medicinal chemistry because of its function in the regulation of gene expression, site-specific cleavage of DNA, gene mapping and isolation, the maintenance of folded chromosome conformations, and gene-targeted mutagenesis. The researchers argue that in a pyrimidine-motif triplex DNA, the (homopyrimidine) triplex-forming oligonucleotide (TFO) binds to the homopurine tract of the target duplex DNA. This binding is sequence specific and maintained through Hoogsteen hydrogen bonds to form T·A:T and C+·G:C triads. The formation of the C+·G:C triad depends on the protonation of cytosine, which is only favorable at acidic pH values (pKa=4.5). Therefore, homo-pyrimidine-motif triplexes are extremely unstable at physiological pH values severely limiting their biological application. The group synthesized a novel bridged nucleic acid analogue, 2’,4’-BNA^NC, and demonstrated that the TFOs composed of 2’,4’-BNA^NC formed highly stable pyrimidine-motif triplexes at physiological pH values. Furthermore they show that the TFOs eliminate the requirement of placing alternating DNA monomers for optimum efficacy needed when using LNAs. They could show that fully modified TFOs still formed a highly stable triplex. They stated that “these promising properties of 2’,4’-BNA^NC will be helpful for developing oligonucleotide-based technologies for the postgenome era.”

Also in 2007, Imanishi’s group synthesized oligonucleotides that were modified with a novel BNA analogue, 2’, 4’-BNA^NC[N–CH₃], and compared their properties to oligonucleotides containing 2’,4’-BNA (LNA). They showed that these oligonucleotides have a similarly high RNA affinity but a better selectivity for RNA and a much higher resistance to nuclease degradation. These results suggested that the novel BNA analogue may be particularly useful for antisense approaches when used for the design of antisense oligonucleotides.

Kasahara et al. in 2010 published a paper in where they showed that the capping of the 3’-ends of thrombin binding aptamers (TBAs) with bridged nucleotides increased the nuclease resistances and the stability of the aptamers in human serum. The capping did not affect the binding abilities of the aptamers. The researchers report that the capping could be achieved via a one step enzymatic process using 2’, 4’-bridged nucleoside 5’-triphosphate and the enzyme terminal deoxynucleotidyl transferase.

In the same year Rahman et al. reported the results of their study in which a number of 2’,4’-BNA- and 2’,4’-BNA^NC-modified siRNAs were designed and synthesized. The thermal stability, nuclease resistance and gene silencing properties against cultured mammalian cells were evaluated and compared with those of natural siRNAs. The 2’,4’-BNA- and 2’,4’-BNA^NC-modified siRNAs showed very high T_M values and were remarkably stable in serum samples. Furthermore, the researchers report that these modified oligo-nucleotides showed promising RNAi properties that were equal to those exhibited by natural siRNAs. The thermally stable siBNAs composed of slightly modified sense and antisense strands suppressed gene expression equal to that of natural siRNA. The modifications at the Argonaut (Ago2) cleavage site of the sense strand (9–11th positions from the 5’-end of the sense strand) produced variable results depending on siRNA composition. However, modification at the 10th position diminished siRNA activity. In moderately modified siRNAs, modification at the 11th position displayed usual RNAi activity, while modification at the 9th position showed variable results depending on the composition of the siRNA.

Yamamoto et al. in 2012 demonstrated that BNA-based antisense therapeutics can be used to successfully inhibit hepatic PCSK9 expression which resulted in a strong reduction of the serum LDL-C levels of mice. These findings support the hypothesis that PCSK9 is a potential therapeutic target for hypercholesterolemia. The researchers state that this is the first time they were able to show that BNA-based antisense oligo-nucleotides (AONs) induced a cholesterol-lowering action in hypercholesterolemic mice. Hypercholesterol-emia is a metabolic condition in which high levels of cholesterol are present in the blood and where elevated levels of lipids and lipoproteins are observed in the blood as well. If untreated higher levels of total cholesterol will increase the risk for cardiovascular disease in particular coronary heart disease.

We expect that BNAs like LNAs will find a widespread use in antisense oligonucleotide technology, where they can be used to stabilize interactions with target RNA and protect them from the attack by cellular nucleases. Furthermore, they can be used in the field of molecular diagnostics and the newly emerging field of siRNAs. Utilizing these modified nucleotides promises to increase double-stranded RNA stability in serum and decrease off-target effects seen with conventional siRNAs. Next, this oligonucleotide technology has the potential to become a new type of therapy to treat a wide variety of diseases, and BNAs will no doubt play a part in future developments of therapeutic and diagnostic oligonucleotides.

Comparison of various nucleic acid analogs

• Design and synthesis of RNAaptamers,
• siRNA,
• antisense probes,
• diagnostics,
• Isolation
• Microarray analysis
• Northern blotting
• Real-time PCR
• In situ Hybridization
• Functional analysis
• SNP detection
• to use as antigens and many others nucleotide base applications.

Mycobacterium tuberculosis peptide libraries

Design of Mtb peptide libraries for targeted research

Tuberculosis, an ancient disease, has become an escalating global health problem in recent years. It is estimated that one-third of the world’s population presently is infected with Mycobacterium tuberculosis (Mtb) and that the bacteria causes 1.7 million deaths annually. On November 20^th, 2012 the news reported that students in Grand Forks, ND, were diagnosed with tuberculosis and health officials reported three new cases of tuberculosis (TB) in Grand Forks, including a student at Valley Middle School. This brought the total number of active cases to 13. An article in the Wall Street Journal on Friday November 23, 2012 reported how the fight against TB made the bacteria stronger. Basically, the use of the standard treatment to cure TB in India and other countries with a high infection rate by giving patients a cocktail of antibiotic drugs at a cost of $9 per month without prior testing for drug-resistant strains, allowed the bacteria to evolve more resistant strains. Additional to the cost for testing in a certified lab to help guide a successful treatment, the cost to treat resistant TB strains amounts to $2,000 per month. Chances are that until an integrated approach that uses testing for drug-resistance together with a targeted treatment is established, the infection rate of TB will continue to increase worldwide.

TB a bacterial infection caused by the bacteria Mycobacterium tuberculosis usually attack the lungs, but can also spread to other parts of the body. TB disperses into the air when a person with TB of the lungs or throat coughs, sneezes or talks. Only a medical examination will tell if a person has been exposed to the bacteria. People with weak immune systems have a higher risk for infection. Symptoms of TB in the lungs may include a bad cough that lasts 3 weeks or longer, weight loss, coughing up blood or mucus, weakness or fatigue, fever and chills, and night sweats. TB can be deadly if not treated properly and it is highly recommend that people experiencing these symptoms go right away to a doctor. Exposure to tuberculosis that includes frequent or prolonged exposure, such as sitting in a small room or confined area for a long period of time with someone who has active TB is infectious. However, people are only contagious when there is active disease in their lungs or throat that has not been treated. TB does not spread through clothes, dishes, floors or furniture. The estimate is that in India the disease kills 300,000 people out of 1.2 billion a year. Unfortunately, anyone can get TB. Individuals with weakened immune systems, including those with AIDS or those infected with HIV, have a higher risk to get infected. Active TB can usually be cured with several medicines taken for a long period of time. Latent TB can be treated to prevent the development of active TB. The standard tuberculosis treatment is to take a combination of antibiotics for half a year or more. If patients quit the therapy prematurely, the risk that drug-resistant strains emerge increases. Mycobacteria are hard to kill and it was assumed that dormant cells less susceptible to antibiotics exist even in patients with active disease. Recently a study discovered that Mycobacteria divide asymmetrically. This behavior generates a population of cells that grow at different rates, have different sizes, and differ in how susceptible they are to antibiotics. This gives the bacteria an increased chance for survival. These new findings may aid in the development of new drugs against the hard to kill Mtb cells.

The origin of the Mtb complex, its spread and demography was studied in 2008 by Wirth et al. using a new approach that employed genetic markers based on mycobacterial interspersed repetitive units. These genetic loci comprise variable numbers and tandem repeat sequences that allowed them to be used as genotyping markers. Similar to microsatellites, they behave as selectively neutral phylogenetic markers if large numbers of loci are used. The research group used these markers to calculate a molecular clock and to model their evolution. They report that the Mtb complex consist of two independent clades. One composed of lineages from humans and a second one composed of lineages from both animal and human isolates. Furthermore, the results provide genetic evidence that the most common ancestor for this bacterial complex emerged some 40,000 years ago from its progenitor in East Africa from where it spread in parallel to human migration routes.

The World Health Organization reports on their web site that “tuberculosis (TB) is second only to HIV/AIDS as the greatest killer worldwide due to a single infectious agent. In 2011, 8.7 million people fell ill with TB and 1.4 million died from TB. Over 95% of TB deaths occur in low- and middle-income countries. TB is among the top three causes of death for women aged 15 to 44. In 2010, there were about 10 million orphan children as a result of TB deaths among parents. TB is a leading killer of people living with HIV causing one quarter of all deaths. Multi-drug resistant TB (MDR-TB) is present in virtually all countries surveyed.” The good news is that the estimated number of people falling ill with tuberculosis each year is slowly declining. The TB death rate dropped 41% between 1990 and 2011. TB occurs in every part of the world. In 2011, the largest number of new TB cases occurred in Asia, accounting for 60% of new cases globally. Sub-Saharan Africa carried the greatest proportion of new cases per population with over 260 cases per 100 000 population in 2011. (Source: http://www.who.int/mediacentre/factsheets/fs104/en/).

Mtb peptide libraries can be used to help developing new vaccines against TB

There is an urgent need to design new antituberculosis vaccines. The anti-TB vaccine presently available has a high variability and is ineffective in adults. The goal for immunologist is to design a vaccine that confers complete protection against the disease. Presently, research is focused on finding new Mtb-specific antigens that can be used to replace or improve the old vaccine. Early innate and adaptive responses to Mtb are critical for the successful containment of the infection. However, these events are poorly understood, in part because low-dose aerogenic inoculation does not trigger a robust early inflammatory response. Complicating this is the fact that very early T-cell responses are difficult to study. There remain many open questions such as if Mtb delays the onset of early immunity, either by accident or design, and if true memory T lymphocytes can be elicited by vaccination. New research tools are now available to help improve our understanding of TB immunity. Studying the host genetic factors such as human leucocyte antigens (HLA) and non-HLA genes/gene products that are associated with the susceptibility to TB has the potential to determine genetic markers that help in understanding predisposition factors that allow for the development of the disease. Establishing a clear picture of the immune response network to this pathogen is essential for the design of effective vaccines. Identification of high-activity binding peptides that are able to inhibit bacterial invasion is a step toward this goal. Ocampo et al. in 2012 report the identification of Mtb Rv3166c protein high-activity binding peptides (HABPs) that were able to inhibit bacterial invasion of U937 (monocyte-derived macrophages) and A549 (type II alveolar epithelial cells) cell lines. The researchers used PCR to confirm the presence and transcription of the rv3166c gene in the Mtb species complex. Western blotting and immunoelectron microscopy was used to evaluate and confirm Rv3166c expression which was found to be present mainly on the cell surface. The research group synthesized sixteen 21mer peptides that covered the entire length of the protein and contained a tyrosine on the C-terminal end. The tyrosine allowed the radiolabeling of the peptides after synthesis using I¹²⁵ to be used in a binding assay. The peptides were tested for their ability to bind to U937 and A549 cells. Two U937 HABPs were identified and three for A549, one of them being shared by both cell lines. Four peptides were identified to inhibited Mtb entry by 15.07–94.06%. These results led the researchers to conclude that Rv3166c HABPs can be used as candidates for further studies contributing towards the search for a multiepitope, chemically synthesized, subunit-based antituberculosis vaccine. The next table lists the peptides used for the study.

The graph shows the Rv3166c peptide binding activity profile. The amino acid sequences and specific U937 and A549 cell binding activities for Rv3166c peptides are listed. Tyr was added at the C-terminal end of those peptides lacking it to facilitate I¹²⁵ radiolabeling. The black bars on the right-hand side represent each peptide’s binding activity determined as the specific binding/total peptide added ratio. The dotted line separates peptides having ≥1% binding activity (Ocampo et al.).

The key to generating good experimental results is the design of the experimental approach on how to use scientific tools such as peptide libraries. Below is the description of the design of peptide libraries or pools using a few selected examples.

Example of peptide library design using the sequence of the hypothetical protein Rv3166c [Mycobacterium tuberculosis H37Rv] NP_217682.1:

1. Non over lapping peptide libraries:

This example shows the design of a non overlapping library. First, select the sequences of peptides to be synthesized. In this case 20mer peptides are selected highlighted in alternating grey shadowing.

The library for this selected protein consists of 16 peptides. The selected peptides can be modified either on the N- or C-terminal end with tyrosine to allow for the use of I¹²⁵ as the radiolabel, cysteine, to allow for conjugation to another compound or to beads, biotin, to allow for binding to avidin or streptavidin coated beads, or any other desired label such as a fluorophore or stable isotope tag, to allow for the coding of the peptides. The use for the downstream analysis tools will determine what type of label needs to be selected.

2. Over-lapping peptide libraries:

The next example shows the design of a library that uses 20mer peptides and an overlap of 11 amino acid residues. This type of peptide library can be designed by using the whole sequence of the original protein or protein domain to generate many equal-length overlapping peptide fragments. Typical applications are continuous epitope mapping and T-cell epitope determination. The “Peptide Library Tools” that can be found on Biosynthesis Inc.’s web site was used for the design. The following link shows the location of the tool: http://www.biosyn.com/PeptideDesignLibrary/PeptideDesignLibrary.aspx.

The resulting list of selected peptides is shown in the following table.
 

Many more permutations of peptide library designs are possible. The resulting libraries can be used to screen highly active compounds such as antigenic peptides, receptor ligands, antimicrobial compounds, protein binding interfaces, and enzyme inhibitors among others.

Major applications are the use of peptide libraries for epitope mapping studies, vaccine research, high-throughput protein interaction analysis, customized peptide microarray production and kinase assays. Epitope mapping requires the design of overlapping peptide libraries, which can be customized by adjusting the fragment length and offset number for the optimum balance between low costs and high data value.

Next, the different library types are explained.

Alanine Peptide Scanning Library: The design of a peptide library in which alanine (Ala, A) is systematically substituted into each of the amino acids which can be used to identify epitope activity. This is sometimes also called an alanine scanning library.

Positional Peptide Library: A selected position in a peptide sequence is systematically replaced with a different amino acid to study the effect of the substituted amino acid at a certain position.

Truncation Peptide Library: A truncation library can be used to predict the minimum amino acid sequence length required for optimum epitope activity.

Random Peptide Library: To design this library selected positions within the original peptide sequence are randomly substituting other natural amino acids in a shot-gun type approach help find potential alternative sequences for enhanced peptide activity.

Scramble Peptide Library: A scrambled library is designed by carrying out permutation on the original peptide's sequence. It has the potential to give all possible alternatives and offers and represents the highest degree of variability per peptide library.

T-cell Truncated Peptide Libraries: This library allows the testing of all possible T-cell epitopes across a protein of interest.

Examples of Mtb peptide libraries and there use found in the literature

Kovjazin in 2010 reported the use of bioinformatic methods to find Mtb peptides with high epitope densities that can be used for vaccine design. Signal peptides and trans-membrane domains were found to have exceptionally high epitope densities. The researchers explain that the major histocompatibility complex (MHC)-binding of these domains relies on their hydrophobic nature and their specific sequence. The research group computed the epitope densities for signal peptides and experimentally confirmed their immunogenicity using a panel of nine synthetic peptides in vitro. The scientists reason that the high epitope density may be the result of an arbitrary overlap between the typical patterns of signal peptides and frequent MHC binding motifs. And that the high epitope density in such domains could be explained on the basis of an evolutionary advantage caused by preferential presentation of hydrophobic sequences especially for the signal peptides. It is known that hostpathogen coevolutionary pressures can change the relative frequency of the different HLA alleles in a population and it is thus possible that HLA alleles preferentially presenting signal peptide epitopes were selected. Highly conserved signal peptide motifs are almost similar in Eukaryotes and Prokaryotes. The authors reason that these results may indicate that pathogens use secreted proteins to manipulate their hosts, and that the host has evolved a mechanisms to present bacterial peptides on MHC-I molecules.

Joosten et al. in 2010 describe responses of human T-cells to Mtb-derived peptides containing predicted HLA-E binding motifs. A total of 69 peptides were used for the study. The CD8+ T-cell is one player of the immune response against Mtb. CD8+ T-cells recognize infected cells through Mtb derived peptides that are presented on HLA class I molecules. The nonclassical HLA molecule HLA-E was studied as presenter of Mtb antigens. The Mtb genome contains multiple sequences that can be presented by human HLA-E. These peptides were recognized by CD8+ T-cells from healthy individuals that were sensitized to Mtb, resulting in CD8+ T-cell proliferation. The investigated T-cells were able to lyse mycobacterium infected cells in a HLA-E restricted manner. Additionally, these T-cells also inhibited proliferation of other T-cells in their vicinity, which is a property of regulatory T-cells.

Dye and Williams report in 2010 that M. tuberculosis is a family of strains and lineages and that the TB epidemiology is changing in the world today. Recent investigations have revealed hypervariable regions in the genome, the African origins and the spread around the world of the pathogen, and which genes code for drug resistance. The data demonstrated that different strains spread more or less quickly through populations and are more or less capable to cause active TB. This indicates that the magnitude of the variations and its epidemiological consequences are mostly unquantified. The analysis of different strains to determine their genetics and phenotypic differences may be needed to allow for a better control of the disease in the future.
 

A brief history of Bridged Nucleic Acids (BNAs)

A quest for better oligonucleotide mimics.

The quest for oligonucleotide mimics with improved characteristics and stabilities useful for molecular diagnostics and therapeutics that also show minimal side effects has led to the design and synthesis of novel bridged nucleic acid monomers and oligonucleotides. These synthetic oligonucleotide mimics may be used as tools for gene validation, as antisense (targeting mRNA) and antigene (targeting DNA) agents, for selective regulation of gene expression and as a potentially new class of drugs for the treatment of diseases such as cancer, inflammation, viral diseases and other pathological diseases. The 3D structures for A-RNA and B-DNA were used as a template for the design of the BNA monomers. The goal for the design is to find derivatives that posses high binding affinities with complementary RNA and/or DNA strands.

RNA contains ribose rather than 2’-deoxyribose in its backbone. The ribose has a hydroxyl group at the 2’-position. Furthermore, RNA contains the nucleic acid uracil in place of thymine and is usually found as a single polynucleotide chain. While RNA is typically single stranded, RNA chains can frequently fold back on themselves to form base-paired segments between short stretches of complementary sequences. The presence of 2’-hydroxyls in the RNA backbone favors a structure that resembles the A-form structure of DNA. The flexible five-membered furanose ring in nucleotides exists in equilibrium of two preferred conformations of the N- (C3’-endo, A-form) and the S-type (C2’-endo, B-form) as depicted in the insert. A closer look at the two forms is shown below. An increased conformational inflexibility of the sugar moiety in nucleosides (oligonucleotides) should result in a gain of high binding affinity with complementary single-stranded RNA and/or double-stranded DNA.

Design of BNA^NC [NMe] modified oligonucleotides

Application	Design example	Length Target	Ref.
Gene Silencing mRNA	5’-NNNnnnnnnnnNNN-3’ 5′-NNnnnNNNnNnnnnnNnNNn-3′	14mer 22mer	Yamamoto et al. 2012
siRNA	5’-NNNnNnnnnnnnnnnnnnnnn-3’ 5’-nnNnnnNnnnNnnnNnnnNnn-3’ 5’-nnnnnnnnnnNnNNnnnnnnn-3’ 5’-nnNnnNnnnnNnnnnNnnnnn-3’	21mer	Rahman et al. 2008 in J. Am. Chem. Soc. 2008, 130, 4886-4896.
Antisense	5’-NNnnnnnnnnnnNN-3’	14mer	Prakash et al in 2010.
Aptamer capping	Thrombin binding aptamer was capped at the 3’-end by using BNA-5’-triphosphates and terminal deoxynucleotidyl transferase		Kasahara et al. 2010 in Bioorganic & Medicinal Chemistry Letters 20(2010) 1626-1629.
Duplex Formation Target ssRNA	5’-d(GCGTTTTTTGCT)-3’ 5’-d(GCGTTTTTTGCT)-3’ 5’-d(GCGTTTTTTGCT)-3’ 5’-r(AGCAAAAACGC)-3’	Tm = 50 Tm = 59 Tm = 80	Rahman et al. 2005 in Nucleic Acids Symposium Series No. 48 pp 5-6
Duplex Formation Target ssRNA	5’-d(GCGTTYTTTGCT)-3’ 5’-d(GCGYTYTYTGCT)-3’ 5’-r(AGCAAAAACGC)-3’ Y = 2’,4’-BNANC [NMe] thymine monomer	Tm = 50 Tm = 63	Rahman et al. 2007 in Nucleosides, Nucleotides, and Nucleic Acids, 26:1625–1628, 2007
Selective Duplex Formation with ssRNA	5’-d(GCGTTTTTGCT)-3’(7) 5’-d(GCGTTTTTTGCT)-3’(8) 5’-d(GCGTTTTTTGCT)-3’(9) Change in melting temperature (ΔTm) of modified oligonucleotides relative to 5’-d(GCGTTTTTTTGCT)-3’ Conditions: 4 mM strands solution in 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl. Target DNA, 5’-d(AGCAAAAAACGC)-3’ Target RNA, 5’-r(AGCAAAAAACGC)-3’		Miyashita et al. Chem. Commun., 2007, 3765–3767.
Duplex Formation Target ssRNA Target ssDNA	5-d(GCGTTTTTTGCT) 5’-r(AGCAAAAAACGT)-3’, Tm = 63 5’-r(AGCAAAAAACGT)-3’, Tm = 51	12mer	Rahman et al. 2008 in J. Am. Chem. Soc. 2008, 130, 4886-4896.
Triplex Formation Target dsDNA	5’-d(TTTTTmCTYTmCTmCTmCT)-3’ 5’-d(GCTAAAAAGAAAGAGAGATCG)-3’ 3’-d(CGATTTTTCTTTCTCTCTAGC)-5’ Y = 2’,4’-BNANC [NMe] thymine monomer, mC = 5-methylcytidine	Tm = 38	Rahman et al. 2007 in Nucleosides, Nucleotides, and Nucleic Acids, 26:1625–1628, 2007
Triplex Formation(TFO) dsDNA	5-d(TTTTTCTTTCTCT) 5’-GCTAAAAAGAAAGAGAGATCG)-3’ 3’-CGATTTTTCTTTCTCTCTCTAGC)-5’ 5’-TTTTTmCTTTmCTmCTmCT-3’ 5’-TTTTTmCTTTmCTmCTmCT-3’ 5’-TTTTTmCTTTmCTmCTmCT-3’ 5’-d(GCTAAAAAGAAAGAGAGATCG)-3’ 3’-d(CGATTTTTCTTTCTCTCTAGC)-5’	Tm = 59 Tm = 57 Tm = 65	Rahman et al. 2008 Rahman et al. 2007 in Angew. Chem. Int. Ed. 2007, 46,4306-4309.
PCR clamping with BNA oligos	The exact ratio of BNA to DNA monomers is dependent on the target Tm value, the length of the oligo, GC%, and target sequence. In general, more than 50% of a15-mer DNA oligo should be modified by BNA-NC units and contain a phosphate group at the 3’-end.	BNA oligos bind more effectively than LNA or PNA oligos.
Telomer Fish Probes
telomere repeat sequence	5’-CCCTAACCCTAACCCTAA-3’	Telomers
major satellite repeats	5’-TCGCCATATTCCAGGTC-3’	Centromeres
(TTAGG)4 repeat	5’-TTAGGTTAGGTTAGG-3’	Repeats
(TTAGGG)n repeat	5’-TTAGGGTTAGGGTTAGGG-3’	Repeats
(CCCTTA)n repeat	5’-CCCTTACCCTTACCCTTA-3’	Repeats
repetitive hexameric sequences	5’-TTAGGGTTAGGGTTAGGG-3’	distal end of chromosomes

N = position of BNA NC [NMe] monomer.

Probes are usually labeled with Cy3 or FITC at the 5’ or 3’ end but other dyes may be used as well.
Concentrations of artificial oligonucleotides and buffers used for BNA experiments by Imanishi and others!

The A/B subfamily of ubiquitously expressed hnRNPs

Precursor mRNA

Spliceosome

The spliceosome is a multimegadalton RNA-protein machine that removes noncoding sequences from nascent pre-mRNAs. Recruitment of the spliceosome to splice sites and subsequent splicing require a series of dynamic interactions among the spliceosome's component U snRNPs and many additional protein factors. Pre-mRNA splicing by the U2-type spliceosome (A) Schematic representation of the two-step mechanism of pre-mRNA splicing. Boxes and solid lines represent the exons (E1, E2) and the intron, respectively. The branch site adenosine is indicated by the letter A and the phosphate groups (p) at the 5′ and 3′ splice sites, which are conserved in the splicing products, are also shown. (B) Conserved sequences found at the 5′ and 3′ splice sites and branch site of U2-type pre-mRNA introns in metazoans and budding yeast (S. cerevisiae). Y = pyrimidine and R = purine. The polypyrimidine tract is indicated by (Yn). (C) Canonical cross-intron assembly and disassembly pathway of the U2-dependent spliceosome. For simplicity, the ordered interactions of the snRNPs (indicated by circles), but not those of non-snRNP proteins, are shown. The various spliceosomal

The DExH/D protein family

Exon definition

Cytoplasmic mRNP granules at a glance

Structure of the Heterogeneous nuclear ribonucleoprotein A1 isoform [Homo sapiens]

The alignment of 3 hnRNP A1 protein sequences is shown below

Protein and Peptide Library Information for hnRNP proteins

Peptide libraries for proteomics

The study of proteomes, sub-proteomes and protein pathways often requires quantitative MS analysis that depends on the identification and validation of SRM and MRM assays. Peptide libraries offer great convenience and flexibility in the development of multiple applications involving large numbers of peptides including libraries for quantitative MS approaches. The use of peptide libraries greatly reduces the setup time of MS experiments. The SRMAtlas (http://www.mrmatlas.org/) which attempts to map the entire human proteome can be used as a guide for the development of new types of peptide libraries.

Peptides libraries can be derived from the target protein, and, as an option for the use in MS workflows, with either arginine (R) or lysine (K) as the C-terminal amino acid. Synthetic libraries can cover the most commonly used tryptic proteotypic peptides useful for SRM assay development or proteolytic peptides of the whole protein. The maximum peptide length for screening libraries can range from short peptides (5 amino acids) to 20 amino acids. However, for peptide libraries used in MS workflows the standard maximal length is usually 25 amino acids but this length can be increased up to 35 amino acids to ensure that the vast majority of potential proteotypic peptides that are screened for their suitability for a reliable SRM assay are covered.

Highlights:
 

• Convenient– peptides are provided in individual tubes or in 96-well plates
• Application-specific– C-terminal amino acid of each peptide can be either R or K or any other amino acid
• Easy to use– peptides can be delivered lyophilized or suspended in 0.1% trifluoroacetic acid (TFA) in 50% (v/v) acetonitrile/water
• Flexible– extensive list of available modifications

• Fully synthetic peptides
• Standard mass spectrometric quality control (QC) analysis
• Optional modifications, peptide sizes and levels of QC analysis
• Provided in either in single tubes or 96-well plates

Example of a peptide library for the hnRNP protein useful for MS workflows

Hnrnp A1 protein (up1)

List of Tryptic Peptides

Functional categorization of the proteins for which targeted proteomic assays are available can be found in the MRMAtlas database

Piccoti et al. in 2008 presented the first database of validated SRM assays for ~1500 yeast proteins. The database was constructed by merging the results of more than 650 SRM-triggered MS2 analyses of S. cerevisiae protein digests, carried out on a triple quadrupole-type mass spectrometer. 1324 proteins are represented by assays for at least one of their peptides proteotypic peptides (PTP’s). The database also contains assays for a small number of peptides common to a maximum of two proteins. The peptides were selected because they show intense signal response by electrospray ionization mass spectrometry. Peptide identifications were validated by collecting a full tandem mass spectrum of the peptides in the QQQ-like mass spectrometer also used for SRM measurements. The database is at present the largest resource of validated SRM/MRM assays of any organism. It currently contains assays for 22% of the yeast proteome and the coverage. The database contains assays for yeast proteins involved in all biological processes, as defined by gene ontology (GO) nomenclature. Peptides for proteins spanning all ranges of abundance in yeast are present in the dataset, down to a concentration below 50 molecules/cell.

The MRMAtlas database

Examples of peptide libraries for hnRNP proteins for screening work flows

A: Rrm Domains of HnRNP A1 (up1): Structure ID: PDB: 2LYV_A

Peptide library of 15mers with an overlap of 11 amino acids for HnRNP A1 (up1)

B: Heterogeneous nuclear ribonucleoprotein A1 isoform a [Homo sapiens]

Peptide library of 15mers with an overlap of 11 amino acids for hnRP A1 a, human

C: Heterogeneous nuclear ribonucleoprotein A1 isoform b [Homo sapiens] {hnRNP A1 b, human}

Peptide library of 15mers with an overlap of 11 amino acids for hnRNP A1 b, human

References

BNAs for Duplex and Triplex Formation

2’,4’-BNA (LNA) with a five-membered bridged structure is insufficiently resistant to nucleases, and fully modified 2’,4’-BNA (LNA) oligonucleotides do not have the flexibility required for efficient triplex formation.

BNA analogues with increased steric bulk and less conformational restriction were developed. 2’,4’-BNA^COC has a seven membered bridged structure and exhibits dramatically improved nuclease resistance.

NA-5 = BNA^COC: This modification conversely affects duplex stability [i.e., duplexes formed with this nucleic acid analogue are less stable than those formed by 2’,4’-BNA (LNA)].

ENA, with a six-membered bridged structure, has slightly lower duplex-forming ability and significantly higher nuclease resistance than 2’,4’-BNA (LNA).

Triplex formation with ENA provided variable results compared to that of 2’,4’-BNA (LNA).

2’,4’-BNA^NC, has a six-membered bridged structure with a unique structural feature (N-O bond) in the sugar moiety

The bridged moiety was designed to have a nitrogen atom, which can:

1. Act as a conjugation site
2. Improve duplex and triplex stability by lowering repulsions between the negatively charged backbone phosphates

The nitrogen atom on the bridge can be functionalized by hydrophobic and hydrophilic groups, by steric bulk, or by appropriate functional moieties to:

1. (Control affinity toward complementary strands
2. Regulate resistance against nuclease degradation, and
3. Allows synthesis of functional molecules designed for specific applications in genomics.

Duplex formation with 2’,4’-BNA^NC[NH] chimer:

Duplex formation with 2’,4’-BNA (LNA) chimer:

Duplex formation with 2’,4’-BNA^NC[NMe] chimer:

Duplex formation with 2’,4’-BNA(LNA) chimer:

Conclusion:

ΔT_mvalues in the Table show that any mismatched base in the target RNA strand resulted in a substantial decrease in the T_m of duplexes formed with 2’,4’-BNA^NC-modified oligonucleotides.

ΔT_mvalues of duplexes formed with 2’,4’-BNA^NC[NH]-modified oligonucleotide having T-U, T-G, and T-C arrangements are -14, -5, -17 °C.

These are lower than those of the corresponding natural DNA-RNA duplexes (ΔT_m= -12, -3, and -15 °C, respectively).

Similar to those exhibited by duplexes formed with the 2’,4’-BNA (LNA) oligonucleotide (ΔT_m= -13, -5, and -17 °C, respectively).

The mismatch discrimination profiles of 2’,4’-BNA^NC[NMe] and [NBn] were also similar to that of 2’,4’-BNA (LNA), except in the case of the T-G arrangement for the 2’,4’-BNA^NC[NMe] derivative, as shown in the Table.